ID: 946808687

View in Genome Browser
Species Human (GRCh38)
Location 2:223498843-223498865
Sequence CTGGCATACCCTCCTGTACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 91}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946808687_946808694 -1 Left 946808687 2:223498843-223498865 CCCAGTACAGGAGGGTATGCCAG 0: 1
1: 0
2: 0
3: 6
4: 91
Right 946808694 2:223498865-223498887 GCATCTCCAGGATGGGTGGCCGG No data
946808687_946808691 -8 Left 946808687 2:223498843-223498865 CCCAGTACAGGAGGGTATGCCAG 0: 1
1: 0
2: 0
3: 6
4: 91
Right 946808691 2:223498858-223498880 TATGCCAGCATCTCCAGGATGGG No data
946808687_946808692 -5 Left 946808687 2:223498843-223498865 CCCAGTACAGGAGGGTATGCCAG 0: 1
1: 0
2: 0
3: 6
4: 91
Right 946808692 2:223498861-223498883 GCCAGCATCTCCAGGATGGGTGG No data
946808687_946808690 -9 Left 946808687 2:223498843-223498865 CCCAGTACAGGAGGGTATGCCAG 0: 1
1: 0
2: 0
3: 6
4: 91
Right 946808690 2:223498857-223498879 GTATGCCAGCATCTCCAGGATGG No data
946808687_946808697 22 Left 946808687 2:223498843-223498865 CCCAGTACAGGAGGGTATGCCAG 0: 1
1: 0
2: 0
3: 6
4: 91
Right 946808697 2:223498888-223498910 TGTGATATATTCCTCCTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946808687 Original CRISPR CTGGCATACCCTCCTGTACT GGG (reversed) Intergenic