ID: 946808906

View in Genome Browser
Species Human (GRCh38)
Location 2:223501367-223501389
Sequence GACACCTCAGTGACCAGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946808906_946808907 -8 Left 946808906 2:223501367-223501389 CCAGCTCTGGTCACTGAGGTGTC No data
Right 946808907 2:223501382-223501404 GAGGTGTCCGAAGTTTGTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946808906 Original CRISPR GACACCTCAGTGACCAGAGC TGG (reversed) Intergenic
No off target data available for this crispr