ID: 946811578

View in Genome Browser
Species Human (GRCh38)
Location 2:223531013-223531035
Sequence ACACTGCTGTCCACAGATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946811576_946811578 -7 Left 946811576 2:223530997-223531019 CCACTGAGCTGGTAACACACTGC No data
Right 946811578 2:223531013-223531035 ACACTGCTGTCCACAGATGGTGG No data
946811575_946811578 -6 Left 946811575 2:223530996-223531018 CCCACTGAGCTGGTAACACACTG No data
Right 946811578 2:223531013-223531035 ACACTGCTGTCCACAGATGGTGG No data
946811569_946811578 23 Left 946811569 2:223530967-223530989 CCAGCTGCCTCACGTGATGAGGC No data
Right 946811578 2:223531013-223531035 ACACTGCTGTCCACAGATGGTGG No data
946811573_946811578 16 Left 946811573 2:223530974-223530996 CCTCACGTGATGAGGCAAGGGGC No data
Right 946811578 2:223531013-223531035 ACACTGCTGTCCACAGATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946811578 Original CRISPR ACACTGCTGTCCACAGATGG TGG Intergenic
No off target data available for this crispr