ID: 946812304

View in Genome Browser
Species Human (GRCh38)
Location 2:223538890-223538912
Sequence TAAATCATGAAACCCGTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946812303_946812304 0 Left 946812303 2:223538867-223538889 CCAAGATCTCTTGAGTTCTATCA No data
Right 946812304 2:223538890-223538912 TAAATCATGAAACCCGTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946812304 Original CRISPR TAAATCATGAAACCCGTGCC AGG Intergenic
No off target data available for this crispr