ID: 946813622

View in Genome Browser
Species Human (GRCh38)
Location 2:223553154-223553176
Sequence CTCATTCAGCACATATTTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946813616_946813622 7 Left 946813616 2:223553124-223553146 CCAGCCTGGAAAACCTCCTTAAC No data
Right 946813622 2:223553154-223553176 CTCATTCAGCACATATTTATTGG No data
946813617_946813622 3 Left 946813617 2:223553128-223553150 CCTGGAAAACCTCCTTAACCTAT No data
Right 946813622 2:223553154-223553176 CTCATTCAGCACATATTTATTGG No data
946813620_946813622 -9 Left 946813620 2:223553140-223553162 CCTTAACCTATTGGCTCATTCAG No data
Right 946813622 2:223553154-223553176 CTCATTCAGCACATATTTATTGG No data
946813619_946813622 -6 Left 946813619 2:223553137-223553159 CCTCCTTAACCTATTGGCTCATT No data
Right 946813622 2:223553154-223553176 CTCATTCAGCACATATTTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946813622 Original CRISPR CTCATTCAGCACATATTTAT TGG Intergenic
No off target data available for this crispr