ID: 946815115

View in Genome Browser
Species Human (GRCh38)
Location 2:223569128-223569150
Sequence CTGTATTCACATGTGGAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946815115_946815119 7 Left 946815115 2:223569128-223569150 CCAGGCTCCACATGTGAATACAG No data
Right 946815119 2:223569158-223569180 CTGCACAGCCCAAAACATCCTGG No data
946815115_946815123 27 Left 946815115 2:223569128-223569150 CCAGGCTCCACATGTGAATACAG No data
Right 946815123 2:223569178-223569200 TGGCCATACCTAGTATGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946815115 Original CRISPR CTGTATTCACATGTGGAGCC TGG (reversed) Intergenic
No off target data available for this crispr