ID: 946815123

View in Genome Browser
Species Human (GRCh38)
Location 2:223569178-223569200
Sequence TGGCCATACCTAGTATGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946815118_946815123 -2 Left 946815118 2:223569157-223569179 CCTGCACAGCCCAAAACATCCTG No data
Right 946815123 2:223569178-223569200 TGGCCATACCTAGTATGTCCTGG No data
946815117_946815123 20 Left 946815117 2:223569135-223569157 CCACATGTGAATACAGGAAGCAC No data
Right 946815123 2:223569178-223569200 TGGCCATACCTAGTATGTCCTGG No data
946815114_946815123 28 Left 946815114 2:223569127-223569149 CCCAGGCTCCACATGTGAATACA No data
Right 946815123 2:223569178-223569200 TGGCCATACCTAGTATGTCCTGG No data
946815115_946815123 27 Left 946815115 2:223569128-223569150 CCAGGCTCCACATGTGAATACAG No data
Right 946815123 2:223569178-223569200 TGGCCATACCTAGTATGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946815123 Original CRISPR TGGCCATACCTAGTATGTCC TGG Intergenic
No off target data available for this crispr