ID: 946818787

View in Genome Browser
Species Human (GRCh38)
Location 2:223609147-223609169
Sequence ATATTTCAGCCCAATACAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946818787_946818798 22 Left 946818787 2:223609147-223609169 CCCCTTGTATTGGGCTGAAATAT No data
Right 946818798 2:223609192-223609214 GATCTGAGTTCTGCCCTGGAAGG No data
946818787_946818791 0 Left 946818787 2:223609147-223609169 CCCCTTGTATTGGGCTGAAATAT No data
Right 946818791 2:223609170-223609192 GACCCCCTGTGGCTTCACCATGG No data
946818787_946818797 18 Left 946818787 2:223609147-223609169 CCCCTTGTATTGGGCTGAAATAT No data
Right 946818797 2:223609188-223609210 CATGGATCTGAGTTCTGCCCTGG No data
946818787_946818799 30 Left 946818787 2:223609147-223609169 CCCCTTGTATTGGGCTGAAATAT No data
Right 946818799 2:223609200-223609222 TTCTGCCCTGGAAGGCTATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946818787 Original CRISPR ATATTTCAGCCCAATACAAG GGG (reversed) Intergenic
No off target data available for this crispr