ID: 946820161

View in Genome Browser
Species Human (GRCh38)
Location 2:223620772-223620794
Sequence CTGTGAGAGTACATGTATTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946820161_946820168 18 Left 946820161 2:223620772-223620794 CCTTAATACATGTACTCTCACAG No data
Right 946820168 2:223620813-223620835 CTATGATTTTTTTTTATGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946820161 Original CRISPR CTGTGAGAGTACATGTATTA AGG (reversed) Intergenic
No off target data available for this crispr