ID: 946820471

View in Genome Browser
Species Human (GRCh38)
Location 2:223623946-223623968
Sequence ATAAAACTGTGGTTGCTTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946820471_946820477 23 Left 946820471 2:223623946-223623968 CCTGAAAGCAACCACAGTTTTAT No data
Right 946820477 2:223623992-223624014 GTATCACTTTTACCTGGGCCAGG No data
946820471_946820475 17 Left 946820471 2:223623946-223623968 CCTGAAAGCAACCACAGTTTTAT No data
Right 946820475 2:223623986-223624008 TATACTGTATCACTTTTACCTGG No data
946820471_946820476 18 Left 946820471 2:223623946-223623968 CCTGAAAGCAACCACAGTTTTAT No data
Right 946820476 2:223623987-223624009 ATACTGTATCACTTTTACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946820471 Original CRISPR ATAAAACTGTGGTTGCTTTC AGG (reversed) Intergenic