ID: 946820472

View in Genome Browser
Species Human (GRCh38)
Location 2:223623957-223623979
Sequence TAGGAAAACAAATAAAACTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946820472_946820475 6 Left 946820472 2:223623957-223623979 CCACAGTTTTATTTGTTTTCCTA No data
Right 946820475 2:223623986-223624008 TATACTGTATCACTTTTACCTGG No data
946820472_946820477 12 Left 946820472 2:223623957-223623979 CCACAGTTTTATTTGTTTTCCTA No data
Right 946820477 2:223623992-223624014 GTATCACTTTTACCTGGGCCAGG No data
946820472_946820476 7 Left 946820472 2:223623957-223623979 CCACAGTTTTATTTGTTTTCCTA No data
Right 946820476 2:223623987-223624009 ATACTGTATCACTTTTACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946820472 Original CRISPR TAGGAAAACAAATAAAACTG TGG (reversed) Intergenic
No off target data available for this crispr