ID: 946820473

View in Genome Browser
Species Human (GRCh38)
Location 2:223623976-223623998
Sequence GTGATACAGTATATGGATTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946820473_946820483 30 Left 946820473 2:223623976-223623998 CCTAAATCCATATACTGTATCAC No data
Right 946820483 2:223624029-223624051 GAAAACAGAAGTGCTAATATAGG No data
946820473_946820477 -7 Left 946820473 2:223623976-223623998 CCTAAATCCATATACTGTATCAC No data
Right 946820477 2:223623992-223624014 GTATCACTTTTACCTGGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946820473 Original CRISPR GTGATACAGTATATGGATTT AGG (reversed) Intergenic
No off target data available for this crispr