ID: 946820474 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:223623983-223624005 |
| Sequence | GGTAAAAGTGATACAGTATA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 946820474_946820484 | 24 | Left | 946820474 | 2:223623983-223624005 | CCATATACTGTATCACTTTTACC | No data | ||
| Right | 946820484 | 2:223624030-223624052 | AAAACAGAAGTGCTAATATAGGG | No data | ||||
| 946820474_946820483 | 23 | Left | 946820474 | 2:223623983-223624005 | CCATATACTGTATCACTTTTACC | No data | ||
| Right | 946820483 | 2:223624029-223624051 | GAAAACAGAAGTGCTAATATAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 946820474 | Original CRISPR | GGTAAAAGTGATACAGTATA TGG (reversed) | Intergenic | ||