ID: 946820476

View in Genome Browser
Species Human (GRCh38)
Location 2:223623987-223624009
Sequence ATACTGTATCACTTTTACCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946820472_946820476 7 Left 946820472 2:223623957-223623979 CCACAGTTTTATTTGTTTTCCTA No data
Right 946820476 2:223623987-223624009 ATACTGTATCACTTTTACCTGGG No data
946820471_946820476 18 Left 946820471 2:223623946-223623968 CCTGAAAGCAACCACAGTTTTAT No data
Right 946820476 2:223623987-223624009 ATACTGTATCACTTTTACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946820476 Original CRISPR ATACTGTATCACTTTTACCT GGG Intergenic