ID: 946820477

View in Genome Browser
Species Human (GRCh38)
Location 2:223623992-223624014
Sequence GTATCACTTTTACCTGGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946820472_946820477 12 Left 946820472 2:223623957-223623979 CCACAGTTTTATTTGTTTTCCTA No data
Right 946820477 2:223623992-223624014 GTATCACTTTTACCTGGGCCAGG No data
946820473_946820477 -7 Left 946820473 2:223623976-223623998 CCTAAATCCATATACTGTATCAC No data
Right 946820477 2:223623992-223624014 GTATCACTTTTACCTGGGCCAGG No data
946820471_946820477 23 Left 946820471 2:223623946-223623968 CCTGAAAGCAACCACAGTTTTAT No data
Right 946820477 2:223623992-223624014 GTATCACTTTTACCTGGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946820477 Original CRISPR GTATCACTTTTACCTGGGCC AGG Intergenic
No off target data available for this crispr