ID: 946820483

View in Genome Browser
Species Human (GRCh38)
Location 2:223624029-223624051
Sequence GAAAACAGAAGTGCTAATAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946820479_946820483 -4 Left 946820479 2:223624010-223624032 CCAGGAGCCCCAGTACTCTGAAA No data
Right 946820483 2:223624029-223624051 GAAAACAGAAGTGCTAATATAGG No data
946820478_946820483 2 Left 946820478 2:223624004-223624026 CCTGGGCCAGGAGCCCCAGTACT No data
Right 946820483 2:223624029-223624051 GAAAACAGAAGTGCTAATATAGG No data
946820474_946820483 23 Left 946820474 2:223623983-223624005 CCATATACTGTATCACTTTTACC No data
Right 946820483 2:223624029-223624051 GAAAACAGAAGTGCTAATATAGG No data
946820473_946820483 30 Left 946820473 2:223623976-223623998 CCTAAATCCATATACTGTATCAC No data
Right 946820483 2:223624029-223624051 GAAAACAGAAGTGCTAATATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946820483 Original CRISPR GAAAACAGAAGTGCTAATAT AGG Intergenic