ID: 946828330

View in Genome Browser
Species Human (GRCh38)
Location 2:223701964-223701986
Sequence CAGCTGCTCAAGCAGACAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946828329_946828330 -4 Left 946828329 2:223701945-223701967 CCAGAAGAAACTGACGAGTCAGC No data
Right 946828330 2:223701964-223701986 CAGCTGCTCAAGCAGACAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946828330 Original CRISPR CAGCTGCTCAAGCAGACAAA TGG Intergenic
No off target data available for this crispr