ID: 946829097

View in Genome Browser
Species Human (GRCh38)
Location 2:223709452-223709474
Sequence CAGTGTTTCTGATGAGAAGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946829097_946829101 -1 Left 946829097 2:223709452-223709474 CCGACTTCTCATCAGAAACACTG No data
Right 946829101 2:223709474-223709496 GGAGGCCAGAGGACAATGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946829097 Original CRISPR CAGTGTTTCTGATGAGAAGT CGG (reversed) Intergenic
No off target data available for this crispr