ID: 946829101

View in Genome Browser
Species Human (GRCh38)
Location 2:223709474-223709496
Sequence GGAGGCCAGAGGACAATGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946829096_946829101 2 Left 946829096 2:223709449-223709471 CCACCGACTTCTCATCAGAAACA No data
Right 946829101 2:223709474-223709496 GGAGGCCAGAGGACAATGTATGG No data
946829097_946829101 -1 Left 946829097 2:223709452-223709474 CCGACTTCTCATCAGAAACACTG No data
Right 946829101 2:223709474-223709496 GGAGGCCAGAGGACAATGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946829101 Original CRISPR GGAGGCCAGAGGACAATGTA TGG Intergenic
No off target data available for this crispr