ID: 946829235 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:223711203-223711225 |
Sequence | AGGGCCTCAGACACCCAGGC TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
946829235_946829239 | 23 | Left | 946829235 | 2:223711203-223711225 | CCAGCCTGGGTGTCTGAGGCCCT | No data | ||
Right | 946829239 | 2:223711249-223711271 | ATCCTGATCATAACTCTGTGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
946829235 | Original CRISPR | AGGGCCTCAGACACCCAGGC TGG (reversed) | Intergenic | ||