ID: 946829235

View in Genome Browser
Species Human (GRCh38)
Location 2:223711203-223711225
Sequence AGGGCCTCAGACACCCAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946829235_946829239 23 Left 946829235 2:223711203-223711225 CCAGCCTGGGTGTCTGAGGCCCT No data
Right 946829239 2:223711249-223711271 ATCCTGATCATAACTCTGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946829235 Original CRISPR AGGGCCTCAGACACCCAGGC TGG (reversed) Intergenic