ID: 946829239

View in Genome Browser
Species Human (GRCh38)
Location 2:223711249-223711271
Sequence ATCCTGATCATAACTCTGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946829236_946829239 19 Left 946829236 2:223711207-223711229 CCTGGGTGTCTGAGGCCCTGTCT No data
Right 946829239 2:223711249-223711271 ATCCTGATCATAACTCTGTGAGG No data
946829238_946829239 3 Left 946829238 2:223711223-223711245 CCTGTCTCAAAATAAATAAATAA No data
Right 946829239 2:223711249-223711271 ATCCTGATCATAACTCTGTGAGG No data
946829235_946829239 23 Left 946829235 2:223711203-223711225 CCAGCCTGGGTGTCTGAGGCCCT No data
Right 946829239 2:223711249-223711271 ATCCTGATCATAACTCTGTGAGG No data
946829237_946829239 4 Left 946829237 2:223711222-223711244 CCCTGTCTCAAAATAAATAAATA No data
Right 946829239 2:223711249-223711271 ATCCTGATCATAACTCTGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946829239 Original CRISPR ATCCTGATCATAACTCTGTG AGG Intergenic