ID: 946843087

View in Genome Browser
Species Human (GRCh38)
Location 2:223837229-223837251
Sequence CCGCGGCGCCGCGTTGCCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 95}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946843087 Original CRISPR CCGCGGCGCCGCGTTGCCGC AGG Intronic
900109318 1:998883-998905 CCCCGGCGCGGCGTGGCTGCGGG + Intergenic
900513199 1:3069864-3069886 CCGCGGAGCCGGGTGGGCGCCGG - Intronic
900629697 1:3627742-3627764 CGGCAGCTCCGCGTGGCCGCCGG - Intronic
901696699 1:11012950-11012972 CCGCGGTGCCGCGTAGCCTGAGG + Intronic
903349744 1:22710695-22710717 TCGCGGCGGCGCGCGGCCGCCGG + Intergenic
903777123 1:25800291-25800313 GCGCGGCGGCGCGGTGGCGCGGG - Exonic
903813188 1:26046121-26046143 CCGCTGCGCCCCGCGGCCGCCGG + Exonic
905126463 1:35718977-35718999 GCGCGGGGCCGCGTTGACCCAGG + Exonic
905990783 1:42335277-42335299 CGGCGGCGCAGCGACGCCGCAGG - Intronic
912515060 1:110211943-110211965 CCTCGGCGTCGCGGTGCTGCCGG - Exonic
916414040 1:164576400-164576422 GCGCGGCGCCGCGTCGCACCCGG + Intronic
917962346 1:180154981-180155003 CCGCGGGGCCGCGTTAGCGCCGG - Exonic
922730700 1:227947673-227947695 CCGGGGCGCGGCGGGGCCGCCGG - Intronic
1062975969 10:1682956-1682978 CCGCGGTGCTGTGTTACCGCCGG - Intronic
1064209107 10:13348196-13348218 CCGGGCCGCCGCGCTCCCGCCGG + Exonic
1066994750 10:42553207-42553229 CCGCGGCGCAGCGGGGCCACAGG - Intergenic
1071527302 10:86366133-86366155 CGGCCGCGCCGCGCTCCCGCTGG - Intronic
1073392732 10:103192969-103192991 CCGCGCCGCCGCGACGCCTCCGG - Intronic
1076734689 10:132453330-132453352 TCGCGTCCCCGCGTGGCCGCGGG + Intergenic
1078771678 11:14358296-14358318 CCGCGGCTCCGCGTGGTCTCCGG - Intronic
1083436326 11:62646160-62646182 CCGAGGGGCCGCGGGGCCGCAGG + Intronic
1089622448 11:119729496-119729518 CCGCCGCGCCTCGGCGCCGCCGG - Intergenic
1090699148 11:129279151-129279173 CGGCGGCGCGGCGGGGCCGCGGG - Intronic
1091243204 11:134069042-134069064 AAGCCGCGCCGCGCTGCCGCTGG + Exonic
1092383598 12:8018744-8018766 CCGCGCCGCTGCGCTCCCGCCGG + Intergenic
1095261715 12:40105829-40105851 CCGCGGAGCCGCGTCCCCCCGGG - Exonic
1098819090 12:75207494-75207516 CCTCGGCGTCGCGGTGCTGCCGG + Exonic
1101918711 12:108915844-108915866 CCGAGGGCCCGCGTTGCCGTGGG + Exonic
1103779398 12:123389108-123389130 CCGGGGCGCCGCGGCGGCGCTGG + Intronic
1104961543 12:132490481-132490503 CGGCGGCGCCGCGTAGCCGAGGG + Exonic
1112507507 13:99983811-99983833 CCGCGGGGCCGCGCTGCCTGGGG - Intronic
1114483249 14:23048048-23048070 CCCCGGCCCCGCGGAGCCGCTGG - Exonic
1115545455 14:34462026-34462048 CCGCGGGGCCGCATTTCCCCAGG - Intronic
1119742901 14:77026023-77026045 CCCCGGCGCCGCGAAGCCCCCGG + Exonic
1122464889 14:101925276-101925298 CCGGGGCGCCGCGTCGGGGCCGG + Exonic
1122697447 14:103562899-103562921 CCGCGCCGCCGCGCTTCCTCGGG + Intergenic
1122940343 14:104978336-104978358 CCGCTGCCCTGCGCTGCCGCGGG + Exonic
1127789886 15:62390435-62390457 CCGCGGCGCCGCGCGGCACCGGG - Intergenic
1128161031 15:65422950-65422972 CCGCGGCGCCGCGCCTCCCCGGG - Exonic
1129162190 15:73753082-73753104 CCCGGGCGCCGGGTCGCCGCCGG + Intergenic
1133058345 16:3158604-3158626 CCGCGGCGCCGCCTCCCCGAGGG - Intergenic
1134531894 16:14989914-14989936 CCGCCTCGCCGCGCTCCCGCAGG + Intronic
1135404760 16:22190258-22190280 CCGTGGAGCCGCGGGGCCGCCGG - Exonic
1135752207 16:25066723-25066745 CTGCGGCGCCGCCTGCCCGCTGG - Intergenic
1137988669 16:53131115-53131137 CCGCTGCCCCGCGGTGCCCCCGG - Intronic
1139409929 16:66751242-66751264 CGGCGGCGGGGCGTTGCCCCAGG - Intronic
1141608785 16:85169998-85170020 CCGCGGCCCCGCGCAGCCGGGGG - Intergenic
1146126541 17:30235834-30235856 CCGCGGCTCCGCGCTCCCGCTGG + Exonic
1146322630 17:31858906-31858928 CCGCGGGGCCGCGGGGCTGCGGG - Intronic
1148156909 17:45429892-45429914 TCGCGGCGCCGCGTTGCGCAGGG + Intronic
1148744402 17:49910366-49910388 CCGCGGTGCCGCGTTTGAGCCGG + Intergenic
1150790852 17:68199324-68199346 TCGCGGCGCCGCGTTGCGAAGGG - Intergenic
1152543976 17:80991758-80991780 CGGCCGCGCGCCGTTGCCGCGGG - Intronic
1153514424 18:5891154-5891176 TCGGGGCGCCGCGTCCCCGCCGG - Exonic
1160025341 18:75211498-75211520 CCCCGCCGCCGCGCTGCTGCTGG - Intronic
1160784471 19:893003-893025 CGGCTGCGCCGCGTTCCCTCGGG + Intronic
1162901040 19:13795658-13795680 CCCCGGCTCCGCTTGGCCGCGGG - Exonic
927945851 2:27134709-27134731 CCGCGGGGCCGCGTTTCCCGGGG + Intergenic
938338917 2:130522796-130522818 CCGCGCGGCCGCGCTGCTGCAGG + Exonic
938350921 2:130597954-130597976 CCGCGCGGCCGCGCTGCTGCAGG - Exonic
940009518 2:149038941-149038963 TCGCGGGGCCGCGGGGCCGCGGG + Intronic
940009522 2:149038949-149038971 CCGCGGGGCCGCGGGGCCGCGGG + Intronic
942890273 2:180980310-180980332 TCGCGGGGCCGCTGTGCCGCGGG - Intronic
943624250 2:190180891-190180913 CAGCGGCGCCGCCTTCTCGCCGG - Exonic
946843087 2:223837229-223837251 CCGCGGCGCCGCGTTGCCGCAGG + Intronic
1179457361 21:41508406-41508428 CCGCGGCGCAGCGCTGCCCGAGG + Intronic
1179842146 21:44084043-44084065 CCGCTGCACCGCGCTACCGCAGG + Intronic
1182804475 22:33058432-33058454 CCGCGGCGCCCCATTGGCTCGGG + Intergenic
1184035050 22:41914275-41914297 CCGGGGCGCTGCGGTGTCGCGGG + Exonic
950420961 3:12899281-12899303 CCGCGGGGCCGCGTTCCCAGTGG - Exonic
953485064 3:43286885-43286907 CCGCGGCGCGGCCTGGCGGCGGG + Intronic
954735794 3:52705788-52705810 CCGCGGGGCAGCCCTGCCGCCGG + Exonic
955927637 3:64023410-64023432 CCCCTTCGCCGCGATGCCGCTGG - Exonic
961539755 3:127591269-127591291 ACGCGGCGCCGCCATGCCTCGGG + Intronic
963038300 3:141051146-141051168 CCGCGCCGCCGCCTTGGCACAGG + Intergenic
968583238 4:1404470-1404492 CCCCTGCGCAGAGTTGCCGCGGG + Intronic
986928950 5:12794869-12794891 CCTCAGCGCGGCGCTGCCGCAGG - Intergenic
987374009 5:17217825-17217847 CCGCGGCGGCGCGGGGCCACCGG - Intronic
995402509 5:111758038-111758060 GCGCGGCTCCGCGCCGCCGCAGG - Intronic
999188914 5:149731917-149731939 CCGCGGGGCCGCGTGGTCGGTGG + Intronic
999727044 5:154446099-154446121 CCGCGGGGCCCGGGTGCCGCGGG + Exonic
1002580960 5:180209199-180209221 GCGCAGCGCCGCGTTGCTCCGGG - Intergenic
1007644450 6:43369504-43369526 CCTCGGCCCCGCGTCGCCCCGGG + Intergenic
1017672479 6:156779504-156779526 TCGCGGCGCGGCGAGGCCGCCGG - Intronic
1022094464 7:27130261-27130283 TCGCAGCGCCGCGGGGCCGCTGG + Exonic
1022410319 7:30134949-30134971 GCGCGGCGCCGCGCTGTCCCCGG + Exonic
1024539952 7:50468121-50468143 GCGAGGCGCCGCGTTTCCGCAGG - Intronic
1035437728 7:158871595-158871617 CCGAGGTGCCGCGTCGCTGCTGG + Intronic
1037947797 8:22999968-22999990 CGGCGCCGCCGCGCTGCTGCTGG - Intronic
1040080129 8:43276307-43276329 CCGCAGCTCCGCGTCCCCGCTGG - Intergenic
1046770495 8:118112158-118112180 CCCGGCCGCCGCGTTTCCGCAGG - Intergenic
1047961836 8:130016685-130016707 CCGGGGCCCCGCGATGCGGCGGG - Intronic
1059176731 9:112175142-112175164 CCGCGGCGCCGCGGGAGCGCCGG - Exonic
1059304080 9:113340244-113340266 CCCAGGCTCCGCGTTCCCGCCGG - Exonic
1061275888 9:129569199-129569221 CCCCGGCCCCGCGTAGCCCCCGG - Intergenic
1062022562 9:134326358-134326380 CCGCGGCGCTGCGGCGCCGGCGG - Intronic
1062574577 9:137200262-137200284 CCGCCGCGCCGCGCCGCCGCGGG - Exonic
1062574580 9:137200263-137200285 CCGCGGCGGCGCGGCGCGGCGGG + Exonic
1062621227 9:137423367-137423389 CCGCGGCGCCCCCTGGCGGCAGG - Exonic
1185890167 X:3815864-3815886 CTGCGGCGCAGCTTTGCCGACGG - Intergenic
1190024569 X:46912216-46912238 CCGCGGCGCCGCGTTCCAGGTGG - Intergenic
1190285306 X:48957470-48957492 CCGCCGCGCCGCGGCGCCGGGGG + Exonic
1197746075 X:129932705-129932727 CCTCGGCGCCCCGTGGCCGCAGG + Intergenic
1198254745 X:134915022-134915044 CCGCGGCGCCGGGATGCGGGTGG - Intronic