ID: 946843697

View in Genome Browser
Species Human (GRCh38)
Location 2:223840697-223840719
Sequence CTGCCCATCTCAGCCAGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946843697_946843701 -8 Left 946843697 2:223840697-223840719 CCTGGCCTGGCTGAGATGGGCAG No data
Right 946843701 2:223840712-223840734 ATGGGCAGAGGATGCTCTCTGGG No data
946843697_946843700 -9 Left 946843697 2:223840697-223840719 CCTGGCCTGGCTGAGATGGGCAG No data
Right 946843700 2:223840711-223840733 GATGGGCAGAGGATGCTCTCTGG No data
946843697_946843702 -7 Left 946843697 2:223840697-223840719 CCTGGCCTGGCTGAGATGGGCAG No data
Right 946843702 2:223840713-223840735 TGGGCAGAGGATGCTCTCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946843697 Original CRISPR CTGCCCATCTCAGCCAGGCC AGG (reversed) Intergenic
No off target data available for this crispr