ID: 946843709

View in Genome Browser
Species Human (GRCh38)
Location 2:223840774-223840796
Sequence CTCTTCGGTGATTTGGGGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946843709_946843719 9 Left 946843709 2:223840774-223840796 CCATACCCCAAATCACCGAAGAG No data
Right 946843719 2:223840806-223840828 CAGTGAGCTGGACACTTCACAGG No data
946843709_946843721 19 Left 946843709 2:223840774-223840796 CCATACCCCAAATCACCGAAGAG No data
Right 946843721 2:223840816-223840838 GACACTTCACAGGGTTATCTTGG No data
946843709_946843720 10 Left 946843709 2:223840774-223840796 CCATACCCCAAATCACCGAAGAG No data
Right 946843720 2:223840807-223840829 AGTGAGCTGGACACTTCACAGGG No data
946843709_946843717 -3 Left 946843709 2:223840774-223840796 CCATACCCCAAATCACCGAAGAG No data
Right 946843717 2:223840794-223840816 GAGGGAGGCCTGCAGTGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946843709 Original CRISPR CTCTTCGGTGATTTGGGGTA TGG (reversed) Intergenic
No off target data available for this crispr