ID: 946846331

View in Genome Browser
Species Human (GRCh38)
Location 2:223861991-223862013
Sequence GACCAACTTTGTATCCAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 87}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946846328_946846331 19 Left 946846328 2:223861949-223861971 CCATTTGGAAAAGGAGAGAGCAG 0: 1
1: 1
2: 6
3: 37
4: 436
Right 946846331 2:223861991-223862013 GACCAACTTTGTATCCAGACAGG 0: 1
1: 0
2: 1
3: 7
4: 87
946846330_946846331 -4 Left 946846330 2:223861972-223861994 CCTGCTTGTAAAGAAAGGTGACC 0: 1
1: 0
2: 0
3: 7
4: 116
Right 946846331 2:223861991-223862013 GACCAACTTTGTATCCAGACAGG 0: 1
1: 0
2: 1
3: 7
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946846331 Original CRISPR GACCAACTTTGTATCCAGAC AGG Intronic
902735499 1:18398117-18398139 TGCCAGCTTTGTATCCACACTGG + Intergenic
910924560 1:92384952-92384974 GGGCAACTTTGTTGCCAGACTGG - Intronic
911351857 1:96763075-96763097 GACCTCCTTTCTTTCCAGACTGG + Intronic
911933301 1:103932759-103932781 GACCAAGTTTGTGTCCATGCAGG + Intergenic
912129897 1:106587905-106587927 GACCAACTTTGTGGCTAGATGGG + Intergenic
912190116 1:107328541-107328563 GAACATCTTTTTATACAGACAGG + Intronic
919405131 1:197170661-197170683 GACCAACAGTCTACCCAGACAGG - Intronic
920707998 1:208268920-208268942 CACCAGCCTTGTCTCCAGACAGG - Intergenic
924177125 1:241402613-241402635 GAGCATGTTTGTATACAGACAGG - Intergenic
1064164219 10:12972911-12972933 CTCCAACTTTGAATCCAGACAGG + Intronic
1065018889 10:21486249-21486271 GATCCACTTTGTACCCAGAGTGG - Intergenic
1066140764 10:32501797-32501819 GACCATCCACGTATCCAGACTGG - Intronic
1076645538 10:131951921-131951943 GACCATCTTTCTTTCCAGAGTGG + Intronic
1077247426 11:1546499-1546521 GACCAGCTGTGTCTCCAGCCAGG - Intergenic
1077745028 11:4893116-4893138 GACCATTCTTGTATACAGACTGG - Intronic
1091407158 12:216223-216245 GACCCACTTGGTATTCAGACTGG + Intergenic
1091407171 12:216318-216340 GACCCACTTGGTGTTCAGACCGG + Intergenic
1091407201 12:216508-216530 GACCCACTTGGTGTTCAGACTGG + Intergenic
1091407217 12:216603-216625 GACCCACTTGGTATTCAGACTGG + Intergenic
1092930141 12:13308075-13308097 CACCACCTTTGTATCCAAAGAGG + Intergenic
1095187216 12:39214825-39214847 TACCAACTATGTATTCAGCCAGG + Intergenic
1096404026 12:51329752-51329774 GACCAGCTTTGTGTCCAGCCGGG - Exonic
1107275871 13:38678616-38678638 GACCAACTATGTTGACAGACAGG + Intergenic
1112049598 13:95632458-95632480 GACCAGCTTTGTCCCCAGGCAGG - Intronic
1112610932 13:100953721-100953743 GACCATCTTGGTATCCACATAGG + Intergenic
1121982656 14:98468212-98468234 GATCAACTCTGTATCCAGTAGGG - Intergenic
1133149521 16:3817164-3817186 GACCCATTTTATAGCCAGACTGG - Intronic
1133912190 16:10076382-10076404 TGCCAAGTTTGTATCCAGAGTGG + Intronic
1144020442 17:11236385-11236407 GAGAAACTTTGGATTCAGACAGG + Intergenic
1144302041 17:13930411-13930433 GACCAACTTGGTATCCAAAAAGG + Intergenic
1144538691 17:16116577-16116599 GACAAACTATGTTTTCAGACTGG - Intronic
1146375385 17:32290389-32290411 GAGCAATTTTGTGTCCAGATTGG + Intronic
1147927507 17:43954618-43954640 GGCCACCTGTGTATCCAGACTGG + Intronic
1148814139 17:50314507-50314529 CCCCGACTTTGTATCCAGCCGGG + Intergenic
1157999283 18:52597357-52597379 GCCCAACTTGGTATTCAGAGTGG + Intronic
1160156257 18:76436131-76436153 GCCCCCCTTAGTATCCAGACAGG - Intronic
1161623326 19:5310912-5310934 GTCTCACTTTGTCTCCAGACTGG + Intronic
926492335 2:13539821-13539843 AACCAACTTATCATCCAGACAGG - Intergenic
928709880 2:33991853-33991875 GATCAACTTTGAAACCAGCCTGG - Intergenic
930252577 2:49051902-49051924 AATCAACTTTGTATCCATATTGG - Intronic
935465723 2:103395690-103395712 GACAAACTTAGTTTCCAAACAGG + Intergenic
940491625 2:154369257-154369279 CACAAACTTTGTAAACAGACTGG + Intronic
942936842 2:181567829-181567851 GACCAAATATGTATTTAGACAGG + Intronic
946846331 2:223861991-223862013 GACCAACTTTGTATCCAGACAGG + Intronic
1172899858 20:38326516-38326538 GTCCAGGTTTGAATCCAGACAGG - Intronic
949556492 3:5157833-5157855 GGCTGCCTTTGTATCCAGACTGG + Intronic
950048965 3:9971515-9971537 CAGCAACATTGTATTCAGACAGG - Intronic
951858331 3:27223244-27223266 GACGATCCTTGTTTCCAGACAGG - Intronic
952263057 3:31759336-31759358 GGCCAACCTTGTGTCCAGAGAGG - Intronic
956398867 3:68854929-68854951 GAACTGCTGTGTATCCAGACAGG - Intronic
957163252 3:76637117-76637139 GCCCAACTTTGGAACCAGTCAGG + Intronic
958742861 3:98095845-98095867 GACCCCCTGTGTATCCTGACTGG - Intergenic
965948974 3:174280575-174280597 GACCAACTTTATCTCCATATTGG + Exonic
966061422 3:175761027-175761049 CACCAATTTTGTATCAAGATTGG - Intronic
967459982 3:189734397-189734419 GACTAGCTTTGGATTCAGACTGG - Intronic
968662345 4:1803976-1803998 GGCCAACTTTGTCCCCACACTGG - Intronic
969148420 4:5144488-5144510 TACCATATTTGTGTCCAGACAGG - Intronic
980198093 4:129617776-129617798 TACCAGCTTTGTCTTCAGACTGG - Intergenic
981749335 4:148078393-148078415 GAACAACTTTGGAGTCAGACGGG + Intergenic
983203114 4:164883679-164883701 GTCTAACTTTGTTTCCAGGCTGG + Intronic
984303090 4:177949472-177949494 GTACATCTTTGTACCCAGACAGG - Intronic
986323017 5:6649181-6649203 GACCCCCTGTGTATCCACACTGG - Intronic
987710273 5:21495437-21495459 GACCATCTTTGAAAACAGACTGG - Intergenic
988749341 5:34178736-34178758 GACCATCTTTGAAAACAGACTGG + Intergenic
991737596 5:69641928-69641950 GACCATCTTTGAAAACAGACTGG + Intergenic
991760598 5:69914497-69914519 GACCATCTTTGAAAACAGACTGG - Intergenic
991786734 5:70203604-70203626 GACCATCTTTGAAAACAGACTGG + Intergenic
991789172 5:70221654-70221676 GACCATCTTTGAAAACAGACTGG + Intergenic
991813922 5:70496760-70496782 GACCATCTTTGAAAACAGACTGG + Intergenic
991817053 5:70518044-70518066 GACCATCTTTGAAAACAGACTGG + Intergenic
991839829 5:70789547-70789569 GACCATCTTTGAAAACAGACTGG - Intergenic
991879179 5:71203989-71204011 GACCATCTTTGAAAACAGACTGG + Intergenic
991881619 5:71222018-71222040 GACCATCTTTGAAAACAGACTGG + Intergenic
994422225 5:99535542-99535564 GACCATCTTTGAAAACAGACTGG - Intergenic
994460146 5:100061998-100062020 GACCATCTTTGAAAACAGACTGG + Intergenic
994484294 5:100375423-100375445 GACCATCTTTGAAAACAGACTGG + Intergenic
994750704 5:103733771-103733793 GACCAACATTGTAGGCAGAGGGG - Intergenic
1001138071 5:169119068-169119090 GACAGATTTTGGATCCAGACAGG - Intronic
1003594677 6:7463751-7463773 CAGAAACTTTGTTTCCAGACAGG - Intergenic
1005547415 6:26885082-26885104 GACCATCTTTGAAAACAGACTGG + Intergenic
1007100901 6:39245923-39245945 GTCTAGCTTTGTAGCCAGACTGG + Intergenic
1009018178 6:57926149-57926171 GACCATCTTTGAAAACAGACTGG + Intergenic
1019348182 7:540668-540690 GACCAACTCTAAACCCAGACGGG - Intergenic
1028001805 7:85508184-85508206 GACCTAATTTGTAGCCAGATAGG - Intergenic
1030815855 7:114036584-114036606 GTCCCACTTTTTAACCAGACTGG + Intronic
1034165337 7:149021163-149021185 CACCAGCTTTGTAACCAGTCTGG - Intronic
1037818190 8:22122790-22122812 GACCCAGTTTGTCTCCAGCCAGG - Exonic
1038044207 8:23752496-23752518 GGCCAACTTTGAATCGAGGCAGG + Intergenic
1041014869 8:53582992-53583014 GACCAACTTTCTACCCAGCTGGG - Intergenic
1041925775 8:63234721-63234743 GACCCACTTGGTTTCCAAACTGG + Intergenic
1049111417 8:140646654-140646676 GACCAACCTGGCAACCAGACGGG - Intergenic
1187502653 X:19852531-19852553 GACGGACTTTGAGTCCAGACTGG - Intronic
1192020637 X:67386971-67386993 GAACACTTGTGTATCCAGACAGG + Intergenic
1195463219 X:105151058-105151080 GATCAACTTTTTATCAAGACAGG - Intronic
1199753850 X:150846354-150846376 GACCAGCTTTGGAGCCAAACAGG + Intronic
1202057257 Y:20848110-20848132 GACCCACTGTGTATCCAGACTGG - Intergenic