ID: 946859013

View in Genome Browser
Species Human (GRCh38)
Location 2:223982306-223982328
Sequence ATGGAGACTCAGAAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1350
Summary {0: 4, 1: 13, 2: 88, 3: 248, 4: 997}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946859013 Original CRISPR ATGGAGACTCAGAAGGAGGA GGG Intronic
900204456 1:1426143-1426165 AGGGAGACGGAGGAGGAGGAGGG + Exonic
900704369 1:4070702-4070724 ATGTAGAATCAGAGAGAGGAAGG + Intergenic
900724415 1:4206233-4206255 ATAGAGACTCAGAAGTGTGAGGG - Intergenic
900875522 1:5340035-5340057 AAGGAGATTCAGAGGGAGCAGGG + Intergenic
901259070 1:7857948-7857970 ATGAAGTCTCACAAAGAGGAAGG + Intergenic
901584851 1:10280880-10280902 ATGGAAACTGAGAAGGAGTCAGG - Intronic
901748283 1:11389129-11389151 CTGCAGACTCAGAGGGGGGAAGG - Intergenic
902113857 1:14105291-14105313 ATGAAGACTGAGAAGGAGCTGGG + Intergenic
902553940 1:17235682-17235704 ATGCAGACTCAGGAAGGGGAGGG + Intronic
902754403 1:18539800-18539822 ATTGAAACTCAAAAGAAGGAAGG + Intergenic
903049600 1:20590816-20590838 TTGGAGAAGCAGAAGGAAGAGGG + Intronic
903727956 1:25465769-25465791 ATGCAGACTCGGAAAGACGAGGG - Intronic
903751949 1:25628749-25628771 TTGGAGACTCAGAAGGGGGAGGG - Intronic
904287879 1:29464228-29464250 TTGGAGTCTCTGAAGGAGGCAGG - Intergenic
904333957 1:29785046-29785068 GGGGAGACAGAGAAGGAGGAGGG + Intergenic
904574795 1:31498421-31498443 TGGGAGACTGAGCAGGAGGATGG - Intergenic
904586963 1:31586005-31586027 ACTGAGACTCAGAAAGAGAAAGG + Intronic
904883780 1:33720444-33720466 AAGGGGATTCAGAAGGATGAAGG + Intronic
905310688 1:37046903-37046925 GTGGGGGGTCAGAAGGAGGAGGG + Intergenic
905350576 1:37343632-37343654 ATGGAAGCTCAGAGAGAGGAAGG + Intergenic
905714298 1:40134869-40134891 AAGGAGACAGAGAAGGAGAAGGG - Intergenic
905794355 1:40807274-40807296 CTGGAGAGTCACAAGGCGGAAGG + Intronic
906165251 1:43681281-43681303 AAGGAGACTCAGAAGCAGACAGG - Intronic
906180896 1:43817827-43817849 AAGGAGAAGAAGAAGGAGGAAGG - Intronic
906187470 1:43872138-43872160 ATGGGGACTAACAAAGAGGATGG + Intronic
906628775 1:47347111-47347133 AAGGAGGAACAGAAGGAGGAAGG - Intronic
906736161 1:48130938-48130960 ATGGAGACTCAGAAGGGTGAGGG - Intergenic
906882199 1:49603719-49603741 CTGGAGACTCAGAATGGGGGAGG - Intronic
906953205 1:50350783-50350805 ATGGGGAGTCAGAAGGGGGATGG - Intergenic
906994254 1:50773315-50773337 CTGCAGACTCAGAAGTGGGATGG - Intronic
907394291 1:54178531-54178553 ATGTGGAGTCAGAGGGAGGAGGG + Intronic
907410001 1:54277107-54277129 ATGAAGTCACAGAAGGAGAAAGG - Intronic
907651207 1:56296424-56296446 ATTGAGGCTCAGATTGAGGAAGG - Intergenic
908383655 1:63619985-63620007 ATTGAGGCTCAGAAGGACAAGGG + Intronic
908706775 1:66965838-66965860 ATGGAGATACAGCAGAAGGATGG - Intronic
908776958 1:67649701-67649723 AAGGAGAATCAGGAGGAGGTAGG + Intergenic
908805263 1:67924056-67924078 ATGCCCACTCAGAAGGACGAAGG + Intergenic
908959377 1:69676936-69676958 CTGGAGACTCAGAAGGGAAAGGG - Intronic
909053964 1:70800837-70800859 CTGAAGATTCAGAAGGAGCAGGG - Intergenic
910442343 1:87265710-87265732 ATGGGGACTGAGAAGGTGGAAGG + Intergenic
910738487 1:90489193-90489215 TTGGAGACTTGGAGGGAGGAGGG - Intergenic
910943077 1:92558121-92558143 CAGGAGTCCCAGAAGGAGGAAGG - Intronic
911457797 1:98148905-98148927 TTAGAGACTCAGAAGGGGAAAGG + Intergenic
911546319 1:99221967-99221989 ATGGACTCTTAGAAAGAGGAAGG + Intergenic
911795329 1:102068738-102068760 TTAGAGATTCAGAAGGGGGAGGG + Intergenic
911946207 1:104112760-104112782 TTGGAGACTCAAAAGGGGGAAGG - Intergenic
912003539 1:104864322-104864344 TTGGAGACTCTGAAGGGGGAAGG - Intergenic
912521325 1:110246923-110246945 ATGGAGACTCAGAGGGAGAGAGG - Intronic
913099395 1:115549379-115549401 GTAGAGACACAGAAGGAGGGGGG + Intergenic
913576250 1:120178075-120178097 TTAGAGACTTAGAAGGCGGAGGG - Intergenic
915076281 1:153310618-153310640 CTGGAGACCCAGAATGAAGAAGG + Exonic
915098202 1:153478987-153479009 CTGGAGACTAGGGAGGAGGAAGG - Intergenic
915662501 1:157415878-157415900 AAGGAGAGTCAGACGGAGGCAGG - Intergenic
915694891 1:157729888-157729910 TTGGAGACTCAGAAGAAGGAGGG + Intergenic
915983804 1:160442925-160442947 TTGGAGACTCAGAAGCAGGAAGG - Intergenic
916282389 1:163066148-163066170 ATGGAGCCTCAGAAGGATGAGGG - Intergenic
916598874 1:166273102-166273124 ATGGTGACTCAGAGTGGGGAAGG + Intergenic
916636847 1:166680054-166680076 ATGGAGACTGAGAAGGAGGAGGG - Intergenic
916790199 1:168118442-168118464 ATGGAGACTCACGAGGGTGAGGG + Intronic
916902779 1:169247640-169247662 TTGGCGACTCAGAAGAGGGAGGG - Intronic
916964005 1:169916584-169916606 ACGGAGACCCAGGATGAGGAGGG - Intergenic
916998374 1:170326963-170326985 GTGGAGACACTGAAGGAGGCAGG + Intergenic
917354712 1:174115005-174115027 AGAGAAACACAGAAGGAGGAAGG - Intergenic
917410822 1:174758452-174758474 TTGGAGACTCAGAAGGGGAAAGG - Intronic
918002435 1:180510087-180510109 TTAGAGACTCAGCAGGGGGAGGG - Intergenic
918566880 1:185944302-185944324 TTGAAGACTCAGAAGGGAGAGGG + Intronic
918570483 1:185985779-185985801 ATGGAGACACAGAATGATGAAGG - Intronic
918725611 1:187918097-187918119 TTGGAGACTCAGAATGGGGAGGG + Intergenic
918761847 1:188420536-188420558 AGGGAGAGACAGAAGGAGGAAGG - Intergenic
918928876 1:190826700-190826722 ATGGAGATTCAGAAGGGTGAGGG + Intergenic
919038986 1:192357411-192357433 AGGGAGACACAGAAAGAGGGAGG + Intronic
919077954 1:192835641-192835663 AAGCTGACTCAGAAGGAGGGCGG - Intergenic
919211611 1:194494144-194494166 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
919412527 1:197264130-197264152 ATGGAGACTTGGAAGGTTGAGGG - Intergenic
919434826 1:197544954-197544976 AGGGAGAAGGAGAAGGAGGAAGG + Intronic
919492261 1:198219540-198219562 TTGGAGACTCAGAATGGGGAAGG + Intronic
919739943 1:200975336-200975358 ATGGAGACAGAGGAGGAAGAGGG + Intronic
919833066 1:201555661-201555683 AGTGAGGCTCAGAAGGAGGGAGG + Intergenic
920019675 1:202945849-202945871 ATGGAGACTTAGAAGCGGGAGGG + Intronic
920044946 1:203127111-203127133 ATGAAGAGGAAGAAGGAGGAAGG + Exonic
920110500 1:203583857-203583879 AAGGAGAGAGAGAAGGAGGAAGG + Intergenic
920110526 1:203583962-203583984 AAGGAGAGAGAGAAGGAGGAAGG + Intergenic
920611143 1:207438966-207438988 TTGGAGACTCAGAAGGGGGAAGG + Intergenic
920756452 1:208738385-208738407 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
921658997 1:217776723-217776745 ATGAAGGCTCAGACGGAGGGTGG + Intronic
921773752 1:219073096-219073118 TTGGAGACTTGGAAGGTGGAAGG - Intergenic
922237652 1:223734004-223734026 CTGCAGACTCAGGAGGAGGGAGG + Intronic
922279001 1:224104828-224104850 TTGGAGACTCAGAAGCAGGGAGG + Intergenic
922484033 1:225959402-225959424 AAGGCCACTCAGAAGCAGGAAGG - Intergenic
922647199 1:227300658-227300680 GTGGAGACTCAGAAGGGAGAAGG + Intronic
922664387 1:227456188-227456210 TTGGAAATTCTGAAGGAGGATGG - Intergenic
922822322 1:228493140-228493162 CAGGAGGCTGAGAAGGAGGAGGG + Exonic
922860832 1:228814946-228814968 TTAGAGACTCAGAAAGGGGAGGG - Intergenic
922995053 1:229950307-229950329 GTAGAGACTCAGAAGCGGGAGGG - Intergenic
923249345 1:232165764-232165786 TTGGAGACTCAGAGTGGGGAGGG + Intergenic
923469912 1:234281238-234281260 ATGAAGACACAGAAGGGTGATGG + Intronic
923751194 1:236747496-236747518 GTGGAGGCTCAGAAGGGTGAGGG - Intronic
923809356 1:237295293-237295315 CAGGAAAGTCAGAAGGAGGAAGG + Intronic
923880903 1:238103176-238103198 TTAGAGACTCAGCAGGGGGAAGG - Intergenic
924108113 1:240669712-240669734 ATGGAGACTCAGAAGGGTGAAGG - Intergenic
924621992 1:245669971-245669993 TTGGAGACTCCGAAGGGGAAAGG + Intronic
1062805310 10:415383-415405 AAGGAGAGGCAGCAGGAGGAGGG + Intronic
1062947291 10:1471257-1471279 GTGGAGCTTCAGAAGGAGAACGG - Intronic
1063016108 10:2079361-2079383 ATGAAGACACAGAAGGAAGGGGG - Intergenic
1063062823 10:2575930-2575952 AGAGAGAGTCAGGAGGAGGAAGG + Intergenic
1063078507 10:2741425-2741447 ATGGAGACTGGGAAGGGTGAGGG - Intergenic
1063272642 10:4528640-4528662 AAGGAGATTAAGGAGGAGGAAGG + Intergenic
1063281520 10:4634289-4634311 TTGGAGACTGAGAAGGAGGGAGG + Intergenic
1063409817 10:5828662-5828684 ATAGAAACTGAGATGGAGGACGG + Intronic
1063518552 10:6720322-6720344 TTGGAGACTAGGAAGGACGAAGG - Intergenic
1063837331 10:10030578-10030600 CTGAAGACTCAGAAGCAGGGAGG + Intergenic
1064020086 10:11801977-11801999 CTGGAGACTCAGAAGGAGGGAGG + Intergenic
1064245457 10:13664353-13664375 ATGGAGTGTCAGAAAGAGGTTGG + Intronic
1064358991 10:14646342-14646364 CTGGAGACTCAGGAGGAGGGAGG - Intronic
1064594216 10:16926984-16927006 TTGGAGACTCAGAAGTGGGGAGG - Intronic
1064662825 10:17623423-17623445 GTGGAGACTCAGAAGCAGGGAGG - Intergenic
1064832409 10:19485162-19485184 TTGGAAACTCAGAAAGAGGGAGG + Intronic
1064955500 10:20903856-20903878 ATGGAGACTCAGAAGGGAGAAGG + Intronic
1065319690 10:24497813-24497835 TTGGAGACTCAGAAGTGGGCAGG + Intronic
1065423677 10:25576202-25576224 CTGGAGACTCAGAAGGGGTTAGG - Intronic
1065540705 10:26763925-26763947 GTGGAGCTCCAGAAGGAGGAGGG + Exonic
1065736560 10:28758296-28758318 AAGTAGAGACAGAAGGAGGAAGG - Intergenic
1065739580 10:28784768-28784790 ATGCAGACTGAGAAGGAGGCAGG - Intergenic
1065954569 10:30682545-30682567 ATGGTGACTCAGAAAGATGGTGG - Intergenic
1066444499 10:35469654-35469676 ATGGAGAGTCAGACGGGAGATGG + Intronic
1066555257 10:36605476-36605498 ATGGTGACTCAGGATGAAGATGG + Intergenic
1066597788 10:37071062-37071084 TTGGAGACTCAGAAGTGGGGAGG - Intergenic
1066697271 10:38090632-38090654 TTGAAGTCTCAGAAGCAGGAAGG + Intergenic
1066994790 10:42553583-42553605 TTAGAGACTCAGAAGGGGGCTGG + Intergenic
1067010882 10:42712521-42712543 TTGGAGACTCATAAGCAGGGAGG - Intergenic
1067150792 10:43731666-43731688 AAGCAGAAACAGAAGGAGGAAGG - Intergenic
1067550337 10:47229835-47229857 TTGGAAACTCAGAATCAGGAAGG - Intergenic
1067696369 10:48538246-48538268 ACAGAGACACAGAGGGAGGAAGG - Intronic
1067935266 10:50605904-50605926 ATGGAGACTCAGAAGGGTGAAGG - Intronic
1067968518 10:50942282-50942304 ATGGAGCCTCAGAAGTGTGAGGG + Intergenic
1068297636 10:55094734-55094756 GTAGAGACTGAGAAGGAGAAGGG - Intronic
1068465639 10:57387166-57387188 ATGGAGACTCAGAAGCCCAAGGG + Intergenic
1068520635 10:58073468-58073490 CCGGAGACTCAGAAGGAGGGAGG - Intergenic
1068553280 10:58429594-58429616 ATGGAGACTCAGAAGAGTGAAGG - Intergenic
1068635184 10:59340526-59340548 ATGGAGAGTCCGAAGGAACAAGG - Intronic
1068640260 10:59396956-59396978 ATGGAGACTCAGAAGGGTGAGGG - Intergenic
1069067554 10:63959509-63959531 ATACAGATTCAGAAGGGGGAGGG + Intergenic
1069238184 10:66104601-66104623 TTGGAGACTCAGAAGCAGGGAGG - Intronic
1070103495 10:73411284-73411306 TTAGAGACTCAGAAAGGGGAGGG + Intronic
1070313072 10:75287702-75287724 ATGGAGCAGCAGAATGAGGAGGG - Intergenic
1070385633 10:75921836-75921858 AGGAAGGATCAGAAGGAGGAAGG - Intronic
1070843607 10:79504941-79504963 AAGGAGACTAACAATGAGGATGG - Intergenic
1070930059 10:80254659-80254681 AAGGAGACTAACAATGAGGATGG + Intergenic
1071299595 10:84246386-84246408 CTGGAGACTCAGAAGGGGAAGGG - Intronic
1071435965 10:85648506-85648528 ATGGTGACTCAGAGAGAGGGAGG - Intronic
1071679934 10:87694882-87694904 GAGGAAACTCAGAAGGAGTAGGG + Intronic
1072200669 10:93155873-93155895 ATGGAGAATAAGAAAAAGGAAGG + Intergenic
1072223104 10:93344405-93344427 TTGGAGACTCAGAAGGGGGAGGG - Intronic
1072324894 10:94288232-94288254 TTGGAGACTCAGAATGAGAGTGG - Intronic
1072422879 10:95304198-95304220 AAGGACACTGAGAAGGAGCAGGG + Intergenic
1072872907 10:99139271-99139293 CTGGAGACTCAGAAGCAGAAGGG + Intronic
1073248784 10:102109190-102109212 ACGGAGACTCAGATGGGAGAGGG + Intronic
1073431392 10:103489809-103489831 ATGGAGAGAGAGAAAGAGGAAGG + Intergenic
1073637893 10:105218450-105218472 ATGGAAACTCTGTAAGAGGAGGG - Intronic
1074700517 10:116088090-116088112 ATGGAGAACCAGAAGGACAAAGG + Intronic
1074734847 10:116419596-116419618 TTGGAGACTCAGAAGTGGGAGGG - Intergenic
1075007142 10:118839337-118839359 ATGGTGACTCAGACTTAGGAGGG + Intergenic
1075315876 10:121453063-121453085 ATGAAGGCTCAGAAGAAGCAGGG + Intergenic
1075498908 10:122954156-122954178 ATGGAGACGCGGACCGAGGACGG - Exonic
1075987653 10:126801404-126801426 CTGGAGACTCAGAAGGGTGGGGG - Intergenic
1076347583 10:129790391-129790413 TTAGAGACTCAGAAGCGGGAGGG + Intergenic
1077210625 11:1369550-1369572 ATGGAGGACCAGAAGGAGGCAGG + Intergenic
1078636272 11:13053350-13053372 ATGAAGACTTTGCAGGAGGAAGG + Intergenic
1079186392 11:18241736-18241758 CTGGAGACTCAGAAAGATGGAGG + Intronic
1079467799 11:20748563-20748585 TTGGAGACTGAGAAGGCAGAAGG - Intronic
1079536590 11:21522548-21522570 ATGGAGACTCTGAAGGTGTGCGG + Intronic
1079812812 11:25016308-25016330 TTACAGACTCAGAAGGGGGAAGG - Intronic
1079879842 11:25913012-25913034 CTGGAGACTCAAAAGTGGGAAGG + Intergenic
1080510706 11:32967310-32967332 TTGGAGACTCAGAAGGGGAGAGG + Intronic
1080536837 11:33230244-33230266 GTGGAGACTCAGAGGGATGAAGG + Intergenic
1080609292 11:33890128-33890150 CTGGAGACTCAGAAGGGTGGGGG + Intronic
1080675792 11:34425551-34425573 TTTGAGACTCAGAAGGGGGAGGG + Intergenic
1080683554 11:34497055-34497077 TTGAAGAATCAGAAAGAGGATGG + Intronic
1081155908 11:39690144-39690166 TTGGAGACTCAGAAAGGGGAAGG - Intergenic
1081405808 11:42696267-42696289 CTGGAGACTCAGAAGAGGGGAGG + Intergenic
1081641274 11:44755975-44755997 ATGGAGAGAGAGATGGAGGAGGG + Intronic
1081744803 11:45465323-45465345 AGGGAGTCTCAGAGGGAGGGAGG - Intergenic
1081887750 11:46513716-46513738 ATGGAGACTGACAAACAGGAAGG + Intronic
1081906346 11:46672758-46672780 GTGGAGTCGCAGAAAGAGGAAGG + Intronic
1082119269 11:48360618-48360640 TTGGAGACTCAGAAGCGGGAAGG + Intergenic
1082202983 11:49396303-49396325 TTTGAGACTCAGAAGGTGGGAGG - Intergenic
1082255027 11:50024529-50024551 CTGGAGACTCAGAAGCGGGAAGG - Intergenic
1082857692 11:57823628-57823650 ATGGAGAATCAGATGCAAGAAGG + Intergenic
1083132662 11:60640300-60640322 CTGGAGACTCAGAAGCGGGAGGG + Intergenic
1083153085 11:60805778-60805800 ATGGAGACGGAGAAGGAAGAGGG - Intergenic
1083859389 11:65411867-65411889 ATGGAGCACCAGCAGGAGGAAGG - Exonic
1084475520 11:69386516-69386538 ATGGAGGCTCAGAGAGAGAATGG - Intergenic
1084554433 11:69867530-69867552 ATGGAGCATCAGAATGGGGAAGG - Intergenic
1086049252 11:82569328-82569350 ATGGAAGCTCAGAAGGGGGATGG - Intergenic
1086429493 11:86721540-86721562 AAGTAGACTAAGAGGGAGGAGGG + Intergenic
1086445602 11:86867546-86867568 CTAGGGTCTCAGAAGGAGGATGG - Intronic
1086652048 11:89303776-89303798 TTTGAAACTCAGAAGGTGGAAGG + Intergenic
1086845091 11:91739005-91739027 TTGATGACTCAGAAGCAGGAGGG + Intergenic
1086901699 11:92374796-92374818 ATGGAATTTCAGAAGGAAGATGG - Intronic
1088202981 11:107360115-107360137 ATAGAGACTCAGAAGAATAAGGG - Intronic
1088257748 11:107916796-107916818 ATGTGGAGCCAGAAGGAGGATGG - Intronic
1088554126 11:111044332-111044354 AAGGAGACTCAGAAGGGTGGGGG - Intergenic
1088779945 11:113124206-113124228 CTCTAGACTGAGAAGGAGGAAGG + Intronic
1088793629 11:113248748-113248770 GTGGCGACTCAGAAGGAGAAGGG + Intronic
1088996148 11:114999042-114999064 ATGCAGAGCCAGGAGGAGGAAGG + Intergenic
1089826046 11:121278834-121278856 AAAGAGACAAAGAAGGAGGAAGG - Intergenic
1090269615 11:125376962-125376984 ATAGAGGCCCAGAAAGAGGAGGG - Intronic
1090487380 11:127126027-127126049 ATGGAGATTTAGAAGGAGGCTGG - Intergenic
1090511060 11:127376067-127376089 ATGGGTACTAAGAAGTAGGAGGG - Intergenic
1090696898 11:129254383-129254405 GTGGAGAATGGGAAGGAGGAAGG - Intronic
1090883453 11:130855137-130855159 ATGGAGATTCATTAGGAGAAAGG - Intergenic
1091004089 11:131936478-131936500 TTGGAGACTCAGAAGGAGGGTGG + Intronic
1092017325 12:5170115-5170137 ATGCAGAATCGGAAGGCGGAGGG + Intergenic
1092027761 12:5257380-5257402 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
1092882889 12:12901487-12901509 AAGGGGAGTCAGGAGGAGGACGG - Intronic
1092915453 12:13185208-13185230 CTGGAGACTCAGAAGGCGGAGGG + Intergenic
1093012064 12:14117855-14117877 TTGGAGTCCCAGAAGGAGAAGGG + Intergenic
1093456649 12:19371465-19371487 TTGGAGACTCAGAAGGGAGAGGG - Intronic
1093705501 12:22270640-22270662 ATGGAGACTCAGAAAGGTAAAGG + Intronic
1093977971 12:25443907-25443929 TTGGAGACTCAGAAGGGGGAAGG - Intronic
1094143975 12:27209624-27209646 ATGGAGGCTCAGAAGGGGGAGGG + Intergenic
1094166887 12:27452350-27452372 ATGGAGACTCAGGAGGGTGAAGG - Intergenic
1094322101 12:29195858-29195880 ATGGGGACTCAGAAGGACGAGGG - Intronic
1094449550 12:30570059-30570081 ATGGAGACAGAGTAGAAGGATGG - Intergenic
1094619895 12:32069979-32070001 ATGGGGACTCAGAAGGGTGGCGG - Intergenic
1094816512 12:34191756-34191778 ATGGAGACTCAGCAGGGTGAGGG + Intergenic
1095458169 12:42412250-42412272 ATGGAGACTCACAAGCAGGAGGG - Intronic
1095557914 12:43529640-43529662 TTGGAGACTCAGAAGCGGGAGGG + Intronic
1096528423 12:52228139-52228161 AAGGAGAAGAAGAAGGAGGAGGG - Intergenic
1096863114 12:54544323-54544345 ATGCAGATGCAGATGGAGGAGGG - Exonic
1097136330 12:56859523-56859545 ATGGAGACTTGGAAGGGAGAGGG - Intergenic
1097257343 12:57689293-57689315 ATGGAGACTCAGAAGGATGATGG + Intergenic
1097477657 12:60078625-60078647 TTGGAGACTCAGAAGGGGATAGG - Intergenic
1097620952 12:61938893-61938915 TTGGAGACTCAGAAGGAGGAGGG + Intronic
1097988445 12:65808931-65808953 CTGGAAACTGAGAAAGAGGATGG - Intergenic
1098029983 12:66243529-66243551 ATGGATATTGAGAAGGAGGTGGG - Intronic
1098081607 12:66791834-66791856 CTGGAGACTCAGAAGCAGGGAGG - Intronic
1098109359 12:67105505-67105527 ATGGAGACTTGGAAGGGTGAGGG - Intergenic
1098992733 12:77082433-77082455 ATGGAGACTCAGAAGGGTGAGGG + Intergenic
1099164156 12:79281519-79281541 CTGGAGACTCAAAAGTGGGAAGG + Intronic
1099271738 12:80519525-80519547 ATGGGCACTTTGAAGGAGGAGGG + Intronic
1099344044 12:81475815-81475837 CTGGAGGCTGAGAAGGAGAATGG - Intronic
1099355119 12:81624812-81624834 TCAGAGACTCAGAAGGGGGAGGG + Intronic
1099473296 12:83076773-83076795 AGGGAGAATTAGAAGCAGGAGGG - Intronic
1099582571 12:84469689-84469711 ATGGAGATTCAAAAGGGTGAAGG + Intergenic
1099938035 12:89151387-89151409 ATGAAGACTCAGAATGGGGAGGG + Intergenic
1100292076 12:93225309-93225331 TTGGAGACTAAGAAGAGGGAAGG - Intergenic
1100401029 12:94230092-94230114 ATGGAGAATGGGAGGGAGGAGGG - Intronic
1100893853 12:99157643-99157665 CTGGAGACTCAGAAAGGGGGAGG + Intronic
1101117480 12:101546465-101546487 ATGGAGACAGAGTAGAAGGATGG + Intergenic
1101392385 12:104313691-104313713 ATCAAGACTCAGAAGCAGCAAGG - Intronic
1101411494 12:104472564-104472586 ATGGAGACTCAGAAGGATTTAGG + Intronic
1101464474 12:104933906-104933928 CTGGAGACTCAGAAAGGGGGAGG + Intronic
1101520439 12:105477550-105477572 TTAGAGACTCAGAAAGGGGAAGG - Intergenic
1101541627 12:105670780-105670802 ATGGAGTATGAGAAGGAGGTAGG - Intergenic
1101831750 12:108263277-108263299 TTCCAGACTCAAAAGGAGGAAGG - Intergenic
1101946738 12:109143129-109143151 TTGGAGACTCAGAGAGGGGAAGG - Intronic
1102111084 12:110366260-110366282 ATGGAGACTGATAGGGAAGATGG + Intergenic
1102401347 12:112632355-112632377 TTGGAGACTCAGAAAGATGGAGG - Intronic
1102438918 12:112946703-112946725 CAGGGGACTCAGAAGGAAGAAGG - Intronic
1102897308 12:116608953-116608975 CTGGAGACTCAGAAGCGGGGCGG + Intergenic
1102919996 12:116784766-116784788 GTGGAGATATAGAAGGAGGATGG - Intronic
1103105680 12:118222761-118222783 TTGGAGACTCAGAAGAGGAAGGG + Intronic
1103179038 12:118891709-118891731 CTGAAGACTAGGAAGGAGGATGG + Intergenic
1103265887 12:119629755-119629777 ATGGAGACTACGAAGGAGCCAGG + Exonic
1103358785 12:120341838-120341860 AGGGACACACAGAAGGGGGATGG + Exonic
1103841603 12:123869706-123869728 GAGGAGCCTGAGAAGGAGGAAGG - Intronic
1103881953 12:124172922-124172944 ATGGAGACTCTGAAGCCCGAAGG - Intronic
1104062480 12:125280501-125280523 ATGGACACTCAGATTGAGCAAGG - Intronic
1104177613 12:126348201-126348223 CTGGAGACTCGAAGGGAGGAAGG - Intergenic
1104244449 12:127024313-127024335 TTAGAGACTCTGAAGGAGGAAGG + Intergenic
1104428372 12:128696364-128696386 AAGGAGAATCAGAGGTAGGATGG - Intronic
1104462784 12:128969131-128969153 ACAGAGACTGAGAGGGAGGAAGG - Intronic
1104809045 12:131609505-131609527 CTAGAGGCTCAGAAGGAGGAGGG - Intergenic
1104970975 12:132530570-132530592 GTGGAGACCCAGAAGCAGAAGGG - Intronic
1105028605 12:132867086-132867108 AAGGAGCCTCTGAAGAAGGAAGG + Intronic
1105592263 13:21803604-21803626 CTGGAGACTCAGAAGTGGGGAGG - Intergenic
1105726461 13:23167075-23167097 ATGGAGACAGAGTAGAAGGATGG - Intergenic
1105747205 13:23388716-23388738 CTGGAGACTCAGAAGCAGGGAGG + Intronic
1105966340 13:25388181-25388203 AAGGAGAGAAAGAAGGAGGAAGG + Intronic
1106351717 13:28937075-28937097 AGTGATGCTCAGAAGGAGGAGGG + Intronic
1106442694 13:29791653-29791675 ATGGAAACTCTGAGGAAGGAAGG - Intronic
1106572690 13:30941651-30941673 ATGGAGACTCAGAAGCAGAGAGG - Intronic
1107773535 13:43813449-43813471 ATGGAGACTCAGAGGCTGGGTGG - Intergenic
1108008025 13:45972429-45972451 TTGGAGACTCAGAAGGGGGAGGG + Intronic
1108192750 13:47959409-47959431 AGGGAGAGGGAGAAGGAGGAGGG + Intronic
1108252135 13:48577931-48577953 TTTGTGTCTCAGAAGGAGGAAGG - Intergenic
1108271347 13:48762714-48762736 ATTGGGACTCAGAAGTAGTAAGG + Intergenic
1108493832 13:51005489-51005511 ATGGAGCCTGAGAAAGAGGAGGG - Intergenic
1108518918 13:51227255-51227277 ATGGAGACTCAGAGGGCACATGG + Intronic
1108728363 13:53205312-53205334 ATGGAGAGTGACAGGGAGGAGGG - Intergenic
1108738994 13:53315143-53315165 TTGGAGACTCAGAAGAGGGAGGG + Intergenic
1108807476 13:54176715-54176737 ATGCAGACCCAAAAGGAGGAAGG + Intergenic
1108822425 13:54369604-54369626 TTGGAGGCTCAGAAGGGAGAGGG - Intergenic
1108956107 13:56159371-56159393 AGGGAGTCTCAGAAGGCTGAAGG + Intergenic
1109306319 13:60645861-60645883 AAGGAGACTCAGAGTGAGGGAGG - Intergenic
1109377922 13:61522833-61522855 ATGGAGAGCCAGAAGGTGGAGGG + Intergenic
1109399010 13:61800055-61800077 ATGGAGAATGAGAAGGAGAATGG + Intergenic
1109483629 13:62990278-62990300 TTGGAAACTCAGAAGGGAGAGGG - Intergenic
1109585634 13:64398871-64398893 AGGGAGAATCAGAGGAAGGAAGG + Intergenic
1109940797 13:69361373-69361395 TTGAAGACTCAGAAGGGGGAAGG + Intergenic
1110094257 13:71496547-71496569 ATTGAGACTCAGAAGGGTGTGGG + Intronic
1110484264 13:76019768-76019790 ATGGGGACCCAGAAGGGGCATGG + Intergenic
1110778183 13:79433744-79433766 AAGGAGACAGAGGAGGAGGAAGG + Intergenic
1110796944 13:79649952-79649974 TTGGAGACTCGGAAGTAGGGAGG - Intergenic
1111164542 13:84441853-84441875 TTGGAGGCTCAGAAGCAGGGAGG - Intergenic
1111206720 13:85020445-85020467 ATGGGTAGCCAGAAGGAGGAGGG - Intergenic
1111413810 13:87912463-87912485 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1111467837 13:88640844-88640866 ATGGAGACAGAGTAGAAGGATGG - Intergenic
1112143256 13:96670111-96670133 AAGAAGACTAAGAAGGAGCAAGG + Intronic
1112163210 13:96890313-96890335 ATGCAGACACACAAGGAGTAAGG + Intergenic
1112559610 13:100501371-100501393 ATGGAGACTCAGAAGGGTGACGG - Intronic
1112688935 13:101867003-101867025 CTGGAGAATCAGAAGGAAGAAGG + Intronic
1112929240 13:104714023-104714045 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1113050290 13:106203835-106203857 TTGGAGACTCAGAGGGGGAAGGG - Intergenic
1113427423 13:110220675-110220697 AATGATAGTCAGAAGGAGGACGG - Intronic
1113588316 13:111480780-111480802 ATGGGGAGCCAGAAGAAGGAGGG - Intergenic
1114010926 14:18367635-18367657 CTGTAGACTCAGAAGGGTGAGGG + Intergenic
1114451719 14:22830794-22830816 CTGGAGTCTCATAAGGAGAATGG - Intronic
1114661987 14:24352609-24352631 TTGGAGACTCAGATGTGGGAAGG + Intergenic
1114842573 14:26282465-26282487 ATGGAGACGGAGAGGGAGTAGGG + Intergenic
1114952514 14:27773645-27773667 TTGGAGACTCAGAGCGGGGAGGG - Intergenic
1115094535 14:29618964-29618986 CTGGAGAATGAGGAGGAGGAAGG + Intronic
1115275589 14:31605751-31605773 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1115371366 14:32618351-32618373 TTGGCGACTCAGAAGCAGGGAGG - Intronic
1115740382 14:36381550-36381572 TTGGAGACTCAGAAAGAGGGAGG + Intergenic
1115947592 14:38679674-38679696 ATGGAGACTCAGAAGGAGGAGGG - Intergenic
1116042001 14:39697407-39697429 TTGGAGACTCAGAAGGGGGGAGG - Intergenic
1116090067 14:40293733-40293755 ATTGGGAATCAGAAGGGGGATGG + Intergenic
1116142921 14:41023104-41023126 ATGGTGACTCAGAGGAATGAGGG - Intergenic
1116401254 14:44510389-44510411 ATGGAGACTCAGAAGTGTGTGGG - Intergenic
1116688544 14:48074782-48074804 AAGGAGACTAAAAAGAAGGAAGG - Intergenic
1116754774 14:48933362-48933384 TTGGAGACTCAGAAGAGGGGAGG + Intergenic
1116941760 14:50797926-50797948 TGGGAGACTGAGGAGGAGGAGGG + Intronic
1117207162 14:53455300-53455322 CTGGAGACTCAGAAAGAGTGAGG + Intergenic
1117517965 14:56521377-56521399 TTGGAGAGTTAGAAGGGGGAGGG - Intronic
1117640501 14:57793399-57793421 TTGGAGGCTCAGAAGGTAGAAGG - Intronic
1117740135 14:58809526-58809548 ATGGAGTCTCAGAAGGGTGAGGG - Intergenic
1118362602 14:65069082-65069104 ATGGAGCCTCGCAAGGAGCATGG - Intronic
1118433557 14:65747739-65747761 TTAGAGACTCAGAAAGAGGAGGG + Intergenic
1118636977 14:67756961-67756983 ATGGAGACACAGACTGAGAAAGG - Intronic
1120034517 14:79681235-79681257 ATGAAGGCTCAGCAGGAGGAGGG - Intronic
1120139588 14:80913755-80913777 GTGGAGACTCAGAAGGGAGGAGG + Intronic
1120736614 14:88060160-88060182 ATGGAGACAGAGTAGGAGGATGG + Intergenic
1121080412 14:91103397-91103419 ATGGAGACGGAGGAGGAGGGAGG - Intronic
1121485086 14:94308546-94308568 ATGCAGACTCAGAAGCAGGGGGG - Intronic
1121551624 14:94807157-94807179 AAGGAGGCTAAGAGGGAGGAAGG - Intergenic
1121854470 14:97254204-97254226 AAGGAGACACAGAAGGAGGAAGG - Intergenic
1121979508 14:98442485-98442507 ATTGAGACCCAGAAGAACGATGG + Intergenic
1122328350 14:100896383-100896405 ATGGAGACTGAGCAGGACGAGGG + Intergenic
1122638026 14:103139229-103139251 CAGGAGACTCCGCAGGAGGAAGG + Intergenic
1123805172 15:23863337-23863359 ATGGAGGCTCAGAAGCAGAAAGG + Intergenic
1124117713 15:26862915-26862937 CTGGAGACTTAGAAGGGAGAAGG + Intronic
1126138338 15:45414110-45414132 ATAGAGAGTGAGTAGGAGGAGGG + Intronic
1126304046 15:47234501-47234523 TTGGAGACTCAGGAAGGGGAAGG - Intronic
1126475250 15:49058954-49058976 ATGGAGACTCAGAAGGAGGAAGG + Intergenic
1126584024 15:50265653-50265675 ATGGACACGCAGGAGGTGGAAGG + Exonic
1126715864 15:51516795-51516817 TTAGAGACTCAGAAGAGGGAGGG - Intronic
1127155324 15:56118369-56118391 ATGGAGATACAGTAGGATGATGG - Intronic
1127449526 15:59103277-59103299 TTAGAGACTCAGAAGAGGGAGGG - Intergenic
1128183737 15:65626488-65626510 ATGGCGTCTGAGAAGGGGGAGGG + Intronic
1128231452 15:66038354-66038376 ATGGAGGCTCAGAGGCAGGCAGG - Intronic
1128304201 15:66587181-66587203 AAGGAGAAGCAGGAGGAGGAGGG - Intronic
1128555453 15:68628768-68628790 ATGTAGACTCCGGAGGAGGCAGG - Intronic
1128691618 15:69728440-69728462 TTGAAGACTCAGAAGCAGGGAGG - Intergenic
1128716809 15:69914521-69914543 AGAGAGAGACAGAAGGAGGAGGG - Intergenic
1128734705 15:70046684-70046706 GGGGAGACGCAGCAGGAGGAAGG + Intergenic
1128885585 15:71283891-71283913 ATGGAGACTCTGGTGGGGGAGGG + Intronic
1129229502 15:74188983-74189005 ATCGAGACCCAGAGAGAGGAAGG + Intronic
1129645589 15:77428260-77428282 ATGGTAACAAAGAAGGAGGAAGG + Intronic
1129673988 15:77622488-77622510 AGGGAGACTCAGAAAGGTGAGGG + Intronic
1130043073 15:80421240-80421262 TTGGAGACTCAGAAGGGTGGAGG + Intronic
1130073751 15:80671052-80671074 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1130182849 15:81648805-81648827 TTGGAGACTCAGAAGAAGGAAGG - Intergenic
1130374418 15:83315522-83315544 TTGGAGACTCAGAAGCGGGGAGG + Intergenic
1130430439 15:83842031-83842053 ATGGGGAGGCAGAAGGGGGATGG - Intronic
1130712278 15:86294911-86294933 ATGGAGACTCGGAAGGGTCAGGG - Intronic
1130825469 15:87540572-87540594 CTGGAGACTCAGAAGGTAGGAGG + Intergenic
1130930065 15:88419387-88419409 ATGGAAACTCAGAATGACAAAGG + Intergenic
1131080837 15:89533476-89533498 ATGGAGACTCAGAATGCTGAGGG - Intergenic
1131299718 15:91186696-91186718 CTGGAGACTCAGAAGGCTGTGGG + Intronic
1131329377 15:91482519-91482541 TTGGAGACTCAGAAGTGGGGAGG - Intergenic
1131652179 15:94412062-94412084 ATGGAGCCACAGAATGAGGTAGG + Intronic
1131994688 15:98122754-98122776 ATGAAGACTCAGAGAGAAGATGG - Intergenic
1132793413 16:1706343-1706365 ATGGAGATCCAGATGGACGAGGG + Exonic
1132828145 16:1915026-1915048 AGGGAGGCTGAGATGGAGGAGGG - Intronic
1132932186 16:2464406-2464428 CTGGAGCCTCAGAAGGAGGGAGG + Intronic
1133139179 16:3731771-3731793 ATGGAGAAGCACAAGGAGGTAGG - Exonic
1133504395 16:6397093-6397115 TTGGAGTCCCAGAAAGAGGAAGG + Intronic
1133542090 16:6765962-6765984 TTGGAGACTCAGAAGATGGGAGG + Intronic
1133578486 16:7118412-7118434 TCAGAGACTCAGAAGGAGGGAGG + Intronic
1133696258 16:8265838-8265860 TTGGAGACTCAGAAGGGGGAAGG - Intergenic
1133712036 16:8410780-8410802 TTGGAGACTCAGAAGCAGAGAGG + Intergenic
1133802041 16:9092045-9092067 ATGGAGGAGCGGAAGGAGGAGGG + Exonic
1134216351 16:12319808-12319830 ATGGAGACTTCAAAGCAGGAAGG + Intronic
1134287978 16:12879120-12879142 ATGGAGGGAGAGAAGGAGGAAGG - Intergenic
1134747348 16:16598543-16598565 TTGGGGAGTCAGAAGCAGGAAGG + Intergenic
1134998123 16:18755115-18755137 TTGGGGAGTCAGAAGCAGGAAGG - Intergenic
1135200129 16:20430030-20430052 TTGGAGACTCAGAAGGAAGAAGG + Intronic
1135218560 16:20593564-20593586 TTGGAGACTCAGAAGGAGGAAGG - Intergenic
1135904166 16:26495500-26495522 ACAGAGACTCAGAAGGGTGAAGG + Intergenic
1135948590 16:26889844-26889866 TTCCAGACTCAGAAAGAGGAGGG - Intergenic
1135973013 16:27086005-27086027 CTGGAGACTCAGAAGGTGGAGGG + Intergenic
1136507317 16:30713060-30713082 ATGGAGCGACAGAAAGAGGAGGG - Intronic
1136651103 16:31672076-31672098 TTAGAGACTTAGAAGGGGGAGGG - Intergenic
1137830220 16:51537104-51537126 ATGAAGACTCAGAAAGACTAAGG - Intergenic
1137845000 16:51678370-51678392 ATGGATAATCAGAGGCAGGAGGG - Intergenic
1137971708 16:52991915-52991937 CTGGAGACTCAGAATGGGGAGGG + Intergenic
1138135128 16:54514855-54514877 CCGGAGACTTAGAAGGTGGATGG - Intergenic
1138300809 16:55928404-55928426 CTGGAGACTCAGAAGGTGGAAGG + Intronic
1138339863 16:56281569-56281591 AAGGGGACTGAGAAGGAGGGAGG - Intronic
1138462001 16:57154663-57154685 ATGGGGAAACTGAAGGAGGAAGG + Intronic
1138719673 16:59064883-59064905 CTGGAGACTCAGAAGGGTGGGGG - Intergenic
1138741742 16:59318603-59318625 ATGGAGATTCTGAAGGGTGAGGG - Intergenic
1138938956 16:61766146-61766168 TTGGAAACTCAGAAGGGGGTAGG - Intronic
1139023924 16:62789939-62789961 TGAGAGACTCAGAAGGGGGAGGG - Intergenic
1139284455 16:65798071-65798093 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1139305913 16:65986243-65986265 TTGGAGACTCAGAAGGGAAAAGG + Intergenic
1140339859 16:74146849-74146871 TGGGAGGCTCAGGAGGAGGAGGG - Intergenic
1140659629 16:77175435-77175457 TTGGAGACTCGGAAGAAGGTGGG + Intergenic
1140705238 16:77622657-77622679 TTGGAGACTGAGAAAGGGGAAGG - Intergenic
1141030387 16:80582631-80582653 TTAGAGACTCAGAAGGAGGAAGG + Intergenic
1141031919 16:80596599-80596621 ATGGAGGAACAGAAGGATGATGG + Intergenic
1141141657 16:81500382-81500404 AAGGAGAGAGAGAAGGAGGAAGG - Intronic
1141161081 16:81629545-81629567 AAGGAGACAGAGAGGGAGGAAGG - Intronic
1141270990 16:82541123-82541145 AGGGAGAGTCAGGAGGAGGGAGG + Intergenic
1141302691 16:82832446-82832468 AAGGAGGATGAGAAGGAGGAAGG - Intronic
1141515235 16:84539704-84539726 AGGGAGACTCGGGAGGATGAGGG + Intronic
1141867696 16:86762059-86762081 ATGGAAAATCAGAATGAGGAAGG + Intergenic
1141986396 16:87583007-87583029 TTGGAGGCTCAGGAGGAGGTGGG + Intergenic
1142018508 16:87765598-87765620 GTGGAGACTCAGGAGGGGGCGGG + Intronic
1142906401 17:3045315-3045337 ATGTAGACTAAGAAGTGGGAGGG - Intergenic
1143019953 17:3912202-3912224 ATGAAGACACAGGAGGAGTAAGG - Intronic
1143459714 17:7094434-7094456 ATGGGGAATCAGGAAGAGGAAGG - Intergenic
1143642638 17:8207834-8207856 ATGGAGCCTGAGAAGGAGCAGGG + Exonic
1143947426 17:10605466-10605488 TTGGAGAAAGAGAAGGAGGAGGG + Intergenic
1144136700 17:12302117-12302139 CTGGAGACCGAGAAGGAGAATGG - Intergenic
1144300862 17:13922207-13922229 ATGGAAAGCCAGAAGGGGGATGG - Intergenic
1144320844 17:14117926-14117948 ATGGGGAGCCAGAAGGGGGATGG + Intronic
1144628214 17:16856348-16856370 ATGGTGACACACCAGGAGGAGGG + Intergenic
1144951306 17:18995514-18995536 TTGCAGTCTCAGAAGGTGGAAGG + Intronic
1145102825 17:20090891-20090913 ATGGAGACCCATAAGGAATAGGG - Intronic
1145159806 17:20566915-20566937 ATGGCGACACACCAGGAGGAGGG + Intergenic
1145783019 17:27576098-27576120 AAGCAGACTTTGAAGGAGGAGGG - Intronic
1145829896 17:27907450-27907472 ATGGAGAGTCAGAGGAAAGAGGG + Intergenic
1146097659 17:29947401-29947423 ATGGAGACTCAGAAGTGGGAGGG + Intronic
1146542442 17:33709093-33709115 ATGGAGACCCAGAAAGATGTAGG - Intronic
1146614567 17:34344618-34344640 TTGGAGATTCAGAAGGGGGAAGG + Intergenic
1146742552 17:35299223-35299245 ATGGAGAAGGAGAAGGAGCAGGG - Intergenic
1147173319 17:38634694-38634716 TTGGAGACTAAGAAGCAGAATGG - Intergenic
1147260749 17:39208708-39208730 AGGGAGATGCAGAAAGAGGAGGG - Intergenic
1147277726 17:39333146-39333168 AGGGAGACGGAGAGGGAGGAGGG - Intronic
1148019935 17:44547101-44547123 ATGGAGGCTCAGGAGAAGGGGGG + Intergenic
1148387015 17:47241484-47241506 TTGGAGACTCAGAAGGGGGAAGG - Intergenic
1148446235 17:47739287-47739309 ATGGAGACACAGGAAGAGGCTGG - Intronic
1148547351 17:48528501-48528523 ATGGAGAAACAGAAGCAGGCAGG + Intergenic
1148685959 17:49501415-49501437 ATGAAGACTCAGAGGGAAGATGG + Intronic
1148902330 17:50887766-50887788 ATGGAGAGTTGGGAGGAGGAAGG + Intergenic
1149090246 17:52769396-52769418 ATGAAGACCCAGAAGGGAGAGGG + Intergenic
1149235658 17:54587707-54587729 ATAGAGATTCAGTAGAAGGATGG + Intergenic
1149275350 17:55027400-55027422 TTGGAGACTCAGAAGGGGGATGG + Intronic
1149436923 17:56640854-56640876 ATGGAGAGTCAGTAGGTGAACGG + Intergenic
1150433772 17:65139023-65139045 AGGGAGACTAAGGTGGAGGAGGG - Intronic
1150999025 17:70352137-70352159 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1151279933 17:73065882-73065904 AGGGAGGCTCAGAGGCAGGACGG + Intronic
1152332270 17:79680119-79680141 TTCGAGACTCAGAGGCAGGAGGG - Intergenic
1152334570 17:79693173-79693195 ATGGAGACTCTGAATGATGGTGG + Intergenic
1153350835 18:4079521-4079543 CTGGAGACTCAGAAGTGGGGAGG + Intronic
1153361463 18:4202340-4202362 CTGGAGCCTCAGAATGAGGAAGG + Intronic
1153499597 18:5734651-5734673 CTGGAGACTCAGAAGGGTGGAGG + Intergenic
1154083855 18:11282863-11282885 TTGGAGACTCAGAAGGGTGAGGG - Intergenic
1154214961 18:12408739-12408761 ATGGAGACTCTGAAGGGTGAGGG + Intronic
1154246433 18:12703154-12703176 ATGGAGACTCACCATTAGGAGGG - Exonic
1155315134 18:24563740-24563762 ATGGAGACTCAGAAGGGGGACGG - Intergenic
1155771342 18:29704342-29704364 CTGGAGACTCAGAAGGGGGAGGG - Intergenic
1155882829 18:31170949-31170971 ATGGAGAAGATGAAGGAGGATGG + Intergenic
1155905190 18:31442329-31442351 AGGGAGACAGACAAGGAGGAGGG + Intergenic
1156020120 18:32589943-32589965 AAGGAGTCTCAGAAAGAGGGTGG + Intergenic
1156048133 18:32900237-32900259 ATGGAGACAAGGAAGTAGGAGGG + Intergenic
1156439266 18:37167445-37167467 ATGGGGTGTCAGAAGGGGGATGG + Intronic
1156692608 18:39726539-39726561 ATAGAGCCACAGAAGGAGCAGGG - Intergenic
1156768543 18:40689609-40689631 AAGGAGAAAAAGAAGGAGGAGGG - Intergenic
1156895193 18:42238299-42238321 ATGGAGACTTGGAAGGGTGAAGG - Intergenic
1157394702 18:47331860-47331882 AAGCAGACTCAGAAGCTGGAAGG - Intergenic
1157514270 18:48299696-48299718 ATGAAGAGGCTGAAGGAGGATGG + Intronic
1157777396 18:50406382-50406404 AGGGAGACTCACCAGGAGAAAGG + Intergenic
1158187861 18:54791942-54791964 ATGGAGAGCCAGAAGGGAGATGG - Intronic
1158272696 18:55733763-55733785 TTGGAGGGTCAGAAGCAGGAAGG + Intergenic
1158287026 18:55895116-55895138 GAGAAGACTCTGAAGGAGGAAGG + Intergenic
1158369557 18:56784434-56784456 ATGGAGACTCAGAAGGGGAAGGG - Intronic
1158554289 18:58462397-58462419 TTGGAGACTCAGAAGGAAGGTGG - Intergenic
1158768151 18:60481096-60481118 TTGGAGACTCAGAAGGAAGGAGG - Intergenic
1158816423 18:61103169-61103191 CTGGAGACTCAGAAGCAGGGAGG + Intergenic
1158857244 18:61554873-61554895 AAGGAAACCCAGAAGGAAGAGGG + Exonic
1158867777 18:61654551-61654573 ATGGAGTCTCATAAGGTAGAGGG + Intergenic
1159274014 18:66192307-66192329 ATGAAGCCACAGATGGAGGAAGG - Intergenic
1159372548 18:67546852-67546874 ATGGAGACTTTGAGGGACGATGG - Intergenic
1159417604 18:68173259-68173281 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
1159550041 18:69885460-69885482 GAGAAGCCTCAGAAGGAGGAAGG + Intronic
1159637768 18:70826221-70826243 ATAGTTACTCAGATGGAGGATGG - Intergenic
1159768984 18:72526662-72526684 TTGGAGACTCAGATGCAGGGAGG - Intergenic
1159801301 18:72903244-72903266 TTGGAGAATCAGAAGAAGGGAGG - Intergenic
1160331894 18:78001281-78001303 TTAGAGACTCAGAAGGGGAAGGG - Intergenic
1160566814 18:79791018-79791040 AGGGAGAATCAGAGGGAGAATGG - Intergenic
1160601845 18:80019670-80019692 CTGGAGACTAAGAAGGAACAAGG - Intronic
1160827713 19:1088499-1088521 ATGCAGCCTCAGAAGGAACAAGG - Exonic
1161258362 19:3322108-3322130 ATGGGGACATGGAAGGAGGAGGG + Intergenic
1161504683 19:4637497-4637519 ATGGAACCCCAGAGGGAGGAAGG - Intergenic
1161513769 19:4685370-4685392 AGGGAGAGTCAGCAGGCGGAGGG + Intronic
1161530176 19:4784106-4784128 GTGGAGACTCAGAAGCGGGGAGG + Intergenic
1161810858 19:6470450-6470472 ATGGAGACTCAGAGAGGGAAAGG - Intronic
1162756585 19:12864564-12864586 ATGGAGACTCAAAGAAAGGATGG - Intronic
1163162716 19:15475151-15475173 GTGGAGATTCAGAAGGGTGAGGG + Intronic
1163229300 19:15989310-15989332 CTGGAGACTCAGAAGAGGGAAGG - Intergenic
1163272525 19:16262757-16262779 CTGGGGAGTCAGAAGTAGGATGG - Intergenic
1163322571 19:16583212-16583234 AGGGAGAATCCAAAGGAGGAGGG - Intronic
1164443850 19:28300544-28300566 CTGGAGACTCAGAAGGGGGAAGG + Intergenic
1164446399 19:28321267-28321289 GTGGAGATTCAAAAGCAGGAGGG + Intergenic
1164471785 19:28542228-28542250 TGGGAGACTCAGAAGGGGGAGGG + Intergenic
1164648648 19:29876377-29876399 CAGGAGACACAGAAGGAGGCTGG - Intergenic
1164901388 19:31928515-31928537 TTGGAGACTCAGAAGAGGGGAGG + Intergenic
1164922742 19:32101799-32101821 ATGGAGACTCAGAAGGGGGTGGG - Intergenic
1165258148 19:34592402-34592424 AGGGAGACTCAGAGGGATGGAGG + Intergenic
1165474613 19:36023354-36023376 ATGGAGACCCAGAGGCAGGAAGG - Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166207366 19:41280199-41280221 ATGGAGACTCAGAAGTGTTAGGG + Intronic
1166602117 19:44105674-44105696 ATGGAGACTCAAAATGGGGAGGG - Intronic
1166991514 19:46695641-46695663 ATGGAGACAGAGAACCAGGAAGG + Intronic
1167114076 19:47478877-47478899 TTGGAGATTCAGAAGCAGGAAGG + Intronic
1167359165 19:49020700-49020722 ATGGAGACTCAAAGATAGGAGGG + Intergenic
1167396567 19:49233261-49233283 AGGGAGACGCTGAAGGAGAAGGG - Intergenic
1167552285 19:50169485-50169507 ACAGAGACCCAGAAGGGGGAGGG - Intergenic
1167588875 19:50391675-50391697 AGGGAGACTGAGAGGGGGGAGGG + Intronic
1167691752 19:50989258-50989280 CTGGAGACTCAGAAGGGGGAGGG - Intergenic
1167723677 19:51196607-51196629 TTGGAGACTCAGAATGAGGAAGG - Intergenic
1167793385 19:51693966-51693988 ATGGAGACTCAGAGAGGGGGAGG + Intergenic
1168159443 19:54499603-54499625 AAGAAGAGTCAGAAGCAGGAAGG + Intronic
1168290102 19:55353399-55353421 ATGGAGAGGGAGAAGGGGGACGG + Intronic
1168379005 19:55904440-55904462 ATAGAGACTCAGATGAAGCAAGG - Intronic
1168430732 19:56277739-56277761 ATAGAGACTCAGAAGGAAGGAGG + Intronic
924973219 2:150430-150452 AGGAAGACTCAAAGGGAGGAAGG - Intergenic
925092509 2:1166946-1166968 ATGGAGAGCCAGAAGGGGCATGG - Intronic
925572799 2:5330045-5330067 TTATTGACTCAGAAGGAGGAGGG - Intergenic
925596522 2:5560957-5560979 ATGGTCAGTCACAAGGAGGAAGG + Intergenic
925722137 2:6839625-6839647 CTGGAGACTAAGAAGGAACAAGG - Intergenic
926173709 2:10570278-10570300 ATGGTGAGACAGGAGGAGGAAGG + Intergenic
926366075 2:12134042-12134064 ATGGAGAGAGGGAAGGAGGATGG - Intergenic
926414184 2:12632884-12632906 ATGGAGCCTAAGAAGAAGCATGG - Intergenic
926906942 2:17814827-17814849 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
926990082 2:18669671-18669693 CTGGAGACTCAGAAGGGAGGAGG - Intergenic
927049808 2:19316193-19316215 TTGGAGAGTCAGAGGGAGGAGGG - Intergenic
927144662 2:20154947-20154969 TTGGAGTCTCAGAAAGAGGTGGG + Intergenic
927273461 2:21239463-21239485 ATGGAGAAGAAGAAGAAGGAAGG - Intergenic
928031636 2:27784628-27784650 ATAAAGACACAGAAGGAGGAAGG + Intronic
928220427 2:29398691-29398713 CTGGAAACTGGGAAGGAGGAGGG - Intronic
928276194 2:29902371-29902393 ATGCAGATTCAGCAGGATGATGG - Intronic
928479676 2:31669264-31669286 TTTGAGACTCAGAATGGGGAGGG - Intergenic
928761110 2:34584081-34584103 TTGGAGACTGAGAAGTGGGAAGG + Intergenic
929323532 2:40577131-40577153 ATGCTGACTGAGAAGCAGGAAGG + Intronic
929470748 2:42190263-42190285 GGGGGGACTCAGCAGGAGGAGGG - Intronic
929625105 2:43398615-43398637 ATAGAAACTCAGAAGAAGGATGG + Intronic
929679300 2:43973675-43973697 ATGAAGGCTGTGAAGGAGGAAGG - Exonic
929910954 2:46089185-46089207 ATGTAGAATAAGAATGAGGAGGG - Intronic
930463176 2:51710059-51710081 GTGGAGACTCAGAAGGGTGAGGG + Intergenic
930524527 2:52511060-52511082 ATGGAGACTCAGTAACAGGATGG + Intergenic
930528325 2:52559784-52559806 TTAGAGACTCAGAAAGGGGAGGG - Intergenic
930892919 2:56412005-56412027 CTGGAGACTCAGAAGGGTGAGGG + Intergenic
931260659 2:60615544-60615566 ATTGAGAGTGAGAAGGAAGATGG + Intergenic
931781129 2:65580134-65580156 ATGGAGGGGGAGAAGGAGGATGG - Intergenic
932089503 2:68792413-68792435 ACAGAAACTCAGAAGGATGAGGG - Intronic
932299703 2:70657631-70657653 AACGTGAATCAGAAGGAGGATGG - Exonic
932815725 2:74860151-74860173 ATGGAGACTTGGAAGGGTGAGGG + Intronic
932875062 2:75442793-75442815 TTGGAGATTCAGAAGTGGGAAGG + Intergenic
932884416 2:75535766-75535788 TTGGAGACTCAGAATGGGGAAGG + Intronic
933141438 2:78795743-78795765 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
933294827 2:80477515-80477537 ATGGAGACTCAGAATGGGAAAGG - Intronic
933326362 2:80843242-80843264 ATGGAGACTTGAAAGGAGCAGGG + Intergenic
933458335 2:82545669-82545691 ATGGAGACTAAGAAGGGTGGAGG - Intergenic
933904903 2:86882292-86882314 TTGGAGACTCAGAAGGAGGAGGG + Intergenic
933997886 2:87683312-87683334 ATGCACACTCACAAGGTGGATGG - Intergenic
934079851 2:88458572-88458594 AGGGAGACTCACAAGGGGAAGGG - Intergenic
934476541 2:94597282-94597304 TTGGAACCTCAGAAGCAGGAGGG + Intronic
934484794 2:94695637-94695659 TTGGAGACTCAGAGCGGGGAGGG + Intergenic
934735327 2:96687126-96687148 AGGGAGTCTCTGAAGGGGGAGGG - Intergenic
934894039 2:98097253-98097275 TTGGAGACTCAGAAGTGGGGAGG - Intronic
935138819 2:100333142-100333164 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
935147837 2:100408321-100408343 ATGGAGTGGCGGAAGGAGGAGGG - Intronic
935265754 2:101392453-101392475 AATGACACACAGAAGGAGGAAGG + Intergenic
935555843 2:104508744-104508766 ATGGGGACCCACATGGAGGAAGG + Intergenic
935643634 2:105314110-105314132 GTGAAGACACAGAAAGAGGAAGG + Intronic
935827475 2:106965728-106965750 ATGGAGATTCTGCTGGAGGAGGG + Intergenic
936295965 2:111267554-111267576 ATGCACACTCACAAGGTGGATGG + Intergenic
936367325 2:111869870-111869892 TTGGAGACTCAGAAGGAGGAGGG - Intronic
936580027 2:113691493-113691515 ATGGAGACTCAGAAGGGGGAGGG - Intergenic
936596819 2:113856012-113856034 ATGAAGATTCAGAAAGTGGAAGG + Intergenic
937508898 2:122570722-122570744 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
937743712 2:125386501-125386523 ATGGGGAACCAGAAGGGGGAAGG + Intergenic
938115147 2:128597453-128597475 ATGGAAACTGAGAAGGAGATGGG + Intergenic
938132236 2:128726406-128726428 AGAGAGACTCAGAAGGAGCCTGG + Intergenic
938200821 2:129371700-129371722 ATGAAGACTCATAATGGGGAGGG - Intergenic
938526005 2:132131705-132131727 CTGTAGACTCAGAAGGGTGAGGG - Intergenic
938963209 2:136361485-136361507 ATGGAGAGAGAGAAGGAAGAAGG - Intergenic
939106173 2:137951166-137951188 TTGGAGACTCAGAAGTGGAAGGG - Intergenic
939489291 2:142857467-142857489 CTGGAGGCTGAGGAGGAGGATGG + Intergenic
939553129 2:143640284-143640306 ATGGGGAATCAGAAGGAAGAGGG + Intronic
939627101 2:144491144-144491166 ATGGAGTCTCTGAAGGAGCTGGG + Intronic
940347281 2:152640775-152640797 AAGGAGACTGAGAAGAAAGAAGG - Exonic
940488832 2:154330594-154330616 CTGGATAATCAGAAGGAGCAGGG - Intronic
940545974 2:155085858-155085880 ATGCAGACTCAGAAGGAGGAGGG + Intergenic
940733879 2:157427131-157427153 ATAGACACACAGAAGGAGGAAGG + Intronic
941478886 2:165981826-165981848 CTGGAGATTCAGAAGTAGGGAGG - Intergenic
942430450 2:175905825-175905847 ATGGAGATTCAGAAGCATGAGGG - Intergenic
943218704 2:185075782-185075804 ATGTAGAATGAGGAGGAGGAGGG + Intergenic
943265258 2:185722669-185722691 TTGGAGACTTAGAAGTAGGGAGG - Intergenic
943322624 2:186464447-186464469 TTAGAGACTCAGAAGTAGGAGGG + Intergenic
943341359 2:186685736-186685758 CTGGAGACTCAGAAGTGGGGAGG - Intergenic
943795607 2:191989304-191989326 ATGGAAACTCAGACCAAGGATGG + Intronic
943924284 2:193752004-193752026 ATGAAAACTCAGAAGGGTGAGGG - Intergenic
944082401 2:195802859-195802881 GAGGAGACTCAGAAGGGTGAAGG - Intronic
945075774 2:206038066-206038088 ATGAAGACTCAGAAGGGTGACGG + Intronic
945169801 2:206983548-206983570 ATGGGGACTCAGCAGAAGGCAGG + Intergenic
946109672 2:217403543-217403565 AGAGAGACTCAGTTGGAGGAGGG - Intronic
946150517 2:217764156-217764178 TTGGAGACTCAGAAGTGGGGAGG - Intergenic
946156320 2:217809104-217809126 ATGGAGATACAGATGGATGAAGG + Intronic
946210469 2:218143535-218143557 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
946219153 2:218211537-218211559 AAGGAGCCCCAGCAGGAGGAAGG - Intergenic
946479532 2:220040798-220040820 CAGGAGACCCAGAAGGAGCAAGG - Intergenic
946536956 2:220640937-220640959 CTGGAGTCTCTGAAGGAGTAAGG + Intergenic
946795897 2:223352419-223352441 ATAGAGACTCAGAAGCGAGAGGG + Intergenic
946859013 2:223982306-223982328 ATGGAGACTCAGAAGGAGGAGGG + Intronic
946875029 2:224120370-224120392 TTGGAGACTCAGATGGAGGGAGG + Intergenic
947029942 2:225782598-225782620 AGGGAGAAACAGAGGGAGGAAGG - Intergenic
947131508 2:226931477-226931499 TTTGAGACTCAGAAGGGGAAAGG + Intronic
947395239 2:229680227-229680249 AAGGTGACGCAGAAGGAGTATGG + Intronic
947448877 2:230186660-230186682 ATGGAGACTCAGAAAGGAGAGGG - Intronic
947569032 2:231216553-231216575 AAGGAGCCTCAGAGAGAGGATGG + Intronic
947746286 2:232508876-232508898 ATGGAGGCTCAGAGAGAAGAGGG - Intergenic
948299147 2:236888899-236888921 ATTGAGGCTCAGGAGGAGGCAGG - Intergenic
948917520 2:241042897-241042919 CTGGAGTCTGCGAAGGAGGATGG + Intronic
948917542 2:241043065-241043087 TTGGAGTCTGCGAAGGAGGATGG + Intronic
1168752340 20:291695-291717 AAGGAGACTGAAAAGGAGGCAGG - Intergenic
1168974390 20:1953201-1953223 AGGGAGAGAGAGAAGGAGGAAGG + Intergenic
1169083255 20:2810604-2810626 TTGGAGACTCAGAAGGAGGAGGG - Intergenic
1169292283 20:4362982-4363004 ATGGAGACTTGGAAGGGTGAGGG - Intergenic
1169323214 20:4652615-4652637 ATGGAGACTCAGAAGTGGGGAGG - Intergenic
1169416576 20:5422345-5422367 TTAGAGACTCAGAAGCTGGAGGG + Intergenic
1169502911 20:6178177-6178199 ACAGAGACACAGAAGGAGGATGG + Intergenic
1169513731 20:6294267-6294289 CTGGAGACTCAGAAAGGGGGAGG - Intergenic
1169938826 20:10915092-10915114 ATGGAGACTTGGAAGGGTGAGGG + Intergenic
1170059646 20:12245705-12245727 AGTGTGACTCAGAAGTAGGATGG + Intergenic
1170661526 20:18345844-18345866 CCAGAGACTCAGGAGGAGGAAGG + Intergenic
1170779611 20:19412542-19412564 AGGAAGACGGAGAAGGAGGAGGG + Intronic
1170809195 20:19660292-19660314 TTGGAGACTTAGAAGGTGGGGGG - Intronic
1171042073 20:21773917-21773939 CTGCAGACTCAGAAGGTGGGAGG - Intergenic
1171211855 20:23323055-23323077 CTGGAGACTCAGAAGGGGTAGGG + Intergenic
1171778495 20:29394603-29394625 ATGGAGACTCAGCAGGGTGAGGG + Intergenic
1171820265 20:29829893-29829915 AAGGAGACTCAGCAGGGTGAGGG + Intergenic
1171822552 20:29867053-29867075 ATGGAGACTCAGCAGGGTGAGGG + Intergenic
1171822667 20:29868392-29868414 ATGGAGAATCAGGAGAAAGAAGG + Intergenic
1171959787 20:31485483-31485505 AGGGAGACCCAGGAGGAGGCTGG - Intergenic
1172112609 20:32556173-32556195 ATAGAGACACAGAGGGAGGCAGG - Intronic
1172603456 20:36199234-36199256 ACCGAGACCCAGAAAGAGGAAGG + Intronic
1173032826 20:39378284-39378306 CTGGAGGCTCAGAAGCAGGGAGG - Intergenic
1173059618 20:39648747-39648769 TTGGAGATTCAGAATGGGGAGGG + Intergenic
1173131946 20:40402194-40402216 ATGGGGAGTCAGAAGAAGTAAGG - Intergenic
1173532437 20:43780717-43780739 ATGGAGGCTCAGAGAGATGATGG - Intergenic
1173890923 20:46509600-46509622 ATGGAAAATGAGAAGGAGGTGGG - Intronic
1174197928 20:48786380-48786402 AAGGAGACTCAGGGAGAGGAGGG + Intronic
1174284894 20:49465514-49465536 ATGGAAACTCAGAGAGAAGAAGG + Intronic
1174785887 20:53432128-53432150 CTGGAGACTCAGAAGTGGGGAGG - Intronic
1174965032 20:55203007-55203029 ATGGAGGCTGAGAAGGAAGGAGG + Intergenic
1175040577 20:56046458-56046480 TTAGAGACTCAGAAGAAAGAGGG + Intergenic
1175315837 20:58045982-58046004 ATGGGGCCTCAGGAGGAGGAAGG - Intergenic
1175382676 20:58574641-58574663 ATGGAGAGATAGATGGAGGAAGG - Intergenic
1175499785 20:59441631-59441653 ATGGAGAATGACAAGGAGGGAGG + Intergenic
1177112192 21:17042023-17042045 ATGGAGGCTCAGAAGGATTGGGG + Intergenic
1177378921 21:20312538-20312560 CTGGAGACTTAGAAGGTGGGAGG + Intergenic
1177832357 21:26153130-26153152 TTAGAGACTCACGAGGAGGAGGG + Intronic
1177883849 21:26725004-26725026 ATGGAGACTTAGAAGTGGGGAGG - Intergenic
1177905492 21:26967267-26967289 AGGGAGACGAAGTAGGAGGAAGG + Intergenic
1178422361 21:32452707-32452729 ATGGGGAGCCAGAAGGGGGATGG + Intronic
1178434745 21:32548083-32548105 ATGGAGATTTGGAAGGATGAGGG - Intergenic
1179095916 21:38314340-38314362 ATGGGGAGTCAGAAGGGGGATGG - Intergenic
1179313248 21:40215640-40215662 TTGGAGACTCAGAAGTGGGGAGG + Intronic
1179935884 21:44603058-44603080 GTGGAGACAGAGAAGGAGGCTGG + Intronic
1179958691 21:44756047-44756069 ATGGAGAAGAAGAGGGAGGAGGG + Intergenic
1180324268 22:11354597-11354619 ATGGAGACTCAGAAGGGTGAAGG + Intergenic
1180435420 22:15298439-15298461 CTGTAGACTCAGAAGGGTGAGGG + Intergenic
1180926796 22:19560774-19560796 ATGGAGACTTTGAAGGGTGAGGG + Intergenic
1181362923 22:22352762-22352784 CTGCAGACTAAGCAGGAGGAAGG - Intergenic
1181365730 22:22375835-22375857 CTGCAGACTGAGCAGGAGGAAGG - Intergenic
1181422333 22:22810645-22810667 AAGGAGAGGCAGAGGGAGGAGGG - Intronic
1181423671 22:22819135-22819157 AAGGAGGCTCAGAAGGAGAGCGG - Intronic
1181466330 22:23112539-23112561 ATGGACACTTAGCAGGAGGCTGG + Intronic
1181673851 22:24439362-24439384 AGGGACACTCAGAAGGTGCAAGG - Intronic
1182551329 22:31102384-31102406 ATAGAGGCCCAGAAGGAGCAAGG + Intronic
1182568201 22:31215247-31215269 ATGGAGTCTGAGAAGGAAGTGGG + Intronic
1182859963 22:33551033-33551055 ATGGAAACTCAGAAGGGTAAAGG + Intronic
1182890863 22:33817887-33817909 ATGGAGAAGCTGAAGGAGGGAGG + Intronic
1183034860 22:35133921-35133943 ATGGAGACAAGGGAGGAGGAAGG + Intergenic
1183792849 22:40087776-40087798 CTGGAGACTGAGAGGGAGGCAGG + Intronic
1183896958 22:40977159-40977181 CTGGAGCCTCAGAACCAGGAGGG + Intergenic
1184450850 22:44582002-44582024 ATGGAGTCTCAGGAGGAGGCTGG - Intergenic
1184480909 22:44746341-44746363 ATGGAGAATTTCAAGGAGGAGGG - Intronic
1184530367 22:45051602-45051624 ATGGAGCCTGGGAAGGAGGGTGG - Intergenic
1184555919 22:45233076-45233098 ACTGAGGCTCAGAAGCAGGAGGG - Intronic
1184816729 22:46877879-46877901 AAGGAGACTCGGAAGGTCGATGG + Intronic
1184910966 22:47533871-47533893 ATGGGGACTCAGTGGGACGAAGG + Intergenic
1185050893 22:48553466-48553488 CTGGACACCCAGGAGGAGGATGG + Intronic
949160998 3:881790-881812 ATGGAGACCCACAAGGGTGAGGG - Intergenic
949508016 3:4744873-4744895 AGGGAGACAGAGAGGGAGGAAGG - Intronic
949696927 3:6708372-6708394 ATGGAGACTCAGAAATTGAAAGG - Intergenic
949901832 3:8821522-8821544 ATGGAGGATGAGAAGGAAGAAGG - Intronic
949937416 3:9126758-9126780 ACAGAGACTCAGAAGGGTGAGGG + Intronic
949944179 3:9177221-9177243 ATGGAGACTCCGTAACAGGAGGG - Intronic
949988917 3:9561088-9561110 ATGAAGAGTCAGAAGGGCGAGGG - Intergenic
950128621 3:10526799-10526821 ATAGAGACTCAGAGAGGGGAAGG - Intronic
950199374 3:11032291-11032313 CTGGAGACTCAGAAGGGTGGGGG - Intronic
950488277 3:13285582-13285604 ATGGAGACAGAGAATGAGCAAGG + Intergenic
950802107 3:15561167-15561189 AAGTACACTCAGAAGGAGAAGGG + Intronic
951438519 3:22693951-22693973 TTGGAGACTCGGAAAGGGGATGG - Intergenic
951465522 3:22996988-22997010 ATGGACACTCAGAACTAGTAAGG - Intergenic
951500539 3:23381895-23381917 ATGTAGACTGAGAAGGTGGGAGG + Intronic
952199010 3:31106130-31106152 CTGGAGACTCAGAAGGGTGAAGG - Intergenic
952493147 3:33891235-33891257 TTGGAGACTCAGAAGAGAGAGGG - Intergenic
952557719 3:34552053-34552075 ACGGAGACAGAGAAGGAGGTAGG - Intergenic
952641651 3:35603800-35603822 TTAGAGACTCAGAAGGGGGAGGG + Intergenic
952643374 3:35625390-35625412 TTGGAGACTCAGAAGTGGGATGG - Intergenic
952749202 3:36811533-36811555 TTAGGGACTCAGAAGGTGGAGGG + Intergenic
952849144 3:37713475-37713497 ATTGAGCCACAGAGGGAGGAGGG + Intronic
952899868 3:38103144-38103166 ACGGAGACTCGGAAGGGTGAGGG - Intronic
953028974 3:39163967-39163989 TTGAAGACTCAGAAGTAGGGGGG - Intergenic
953277297 3:41514762-41514784 ATGGAGACTCAGAAGGGTGAGGG + Intronic
953380464 3:42467520-42467542 ATGGAGACTCAGAAGGGTGAAGG + Intergenic
953804287 3:46054529-46054551 ATGGACACTCAAAAGGACGAGGG + Intergenic
953869811 3:46616484-46616506 TTGGAGACTCAGAAGGAAAGAGG - Intronic
953945055 3:47139184-47139206 GTGGAGGCTGAGAGGGAGGAAGG - Intronic
954517205 3:51189418-51189440 TTAGAGACTCAGAAAGGGGAGGG - Intronic
954952064 3:54484270-54484292 ATGGAGAATAGGAAGGAGAATGG - Intronic
955032548 3:55234811-55234833 TTGGAGACTCAGGAGGGGGATGG - Intergenic
955060774 3:55489726-55489748 ATGGAGACTCAGGAGGTAAAGGG - Intronic
955123390 3:56084690-56084712 TTGGAGACTTAGAAGCAGGAAGG + Intronic
955241938 3:57186064-57186086 CTGGAGACTCTGGAGGAGCAGGG - Intergenic
955292766 3:57707772-57707794 ATGGAGACAGAGTAGAAGGATGG + Intergenic
955458235 3:59149339-59149361 CAGGAGACCCAGAAGGAGGATGG - Intergenic
955603856 3:60677315-60677337 CTGGAGACTCAGAATGATGATGG - Intronic
956031075 3:65038772-65038794 ATGGAGACTCAGAAGGGTGAGGG + Intergenic
956078368 3:65530867-65530889 ATGGAGAGAGAGAAAGAGGAGGG + Intronic
956181141 3:66519145-66519167 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
956390830 3:68771106-68771128 ATGGGGAGTCAGAAGGGGGATGG - Intronic
956695328 3:71914038-71914060 TTAGAGACTCAGAATGAGGAGGG - Intergenic
956856093 3:73276273-73276295 TTGGAGACTCAGAAGTAGGCTGG - Intergenic
956864654 3:73357086-73357108 AGGGAGGGTCAGAAGAAGGAAGG - Intergenic
957086661 3:75685952-75685974 ATGGAGACACAGCAGGGTGAGGG - Intergenic
957771681 3:84701413-84701435 ATGAAGACTCAGAAGGGTGTGGG + Intergenic
958001956 3:87761837-87761859 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
958074500 3:88658239-88658261 ATGGGGAGCCAGAAGGCGGATGG + Intergenic
958461124 3:94397254-94397276 ATGAAGACCCAGAAGGATGAGGG + Intergenic
958524684 3:95240810-95240832 ATGGAGAGCTAGAAAGAGGATGG + Intergenic
958580270 3:96009209-96009231 ATAGAGACTTAGAAGTATGAGGG + Intergenic
958859930 3:99434354-99434376 TTGGTGACTCAGAAGGAGAAGGG - Intergenic
958986471 3:100784868-100784890 TTAGAGACCCAGAAGGGGGAGGG + Intronic
959007978 3:101042205-101042227 ATGGCTACAGAGAAGGAGGAAGG - Intergenic
959224786 3:103565835-103565857 AAGGAGACTAAGATGGAGAATGG + Intergenic
959243426 3:103830064-103830086 AAGGAGAAGAAGAAGGAGGAAGG - Intergenic
959352290 3:105281090-105281112 TTGGAGGCTCAGAAGGATGTGGG + Intergenic
959989647 3:112616761-112616783 ATGGAGAAGCAGAAGAAGGAGGG - Exonic
960076204 3:113488586-113488608 TTGGAGACTCAGAAGGGGGAGGG + Intronic
960412560 3:117345769-117345791 AGGGAAACTCAAAAGGATGATGG - Intergenic
960414953 3:117373246-117373268 TTGGATACTCAGAAGGTAGAGGG - Intergenic
960501609 3:118445051-118445073 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
960509716 3:118534493-118534515 ATGGAGCCTCAGAGAGATGATGG + Intergenic
961414730 3:126749039-126749061 AAGGAGACAAAGAATGAGGAGGG + Intronic
961693641 3:128688716-128688738 ATATATACTCTGAAGGAGGAAGG + Intergenic
961880221 3:130056495-130056517 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
961955577 3:130799608-130799630 TCAGAGACTCAGAAGGAGGATGG + Intergenic
961994431 3:131226664-131226686 TTGGAGACTCAGAAGGGAGGAGG + Intronic
962359572 3:134726544-134726566 AGGGAGAGAGAGAAGGAGGAAGG - Intronic
962704961 3:138034139-138034161 ATGGAGACTCAGAAAGTTTAAGG - Intergenic
962937042 3:140090773-140090795 ATCAAGACTCAGAAGCAGGCTGG + Intronic
963854275 3:150238012-150238034 ATGGAGACTGGCACGGAGGAGGG + Intergenic
964629423 3:158794085-158794107 GTAGAGACTCAGAAGGGTGAAGG - Intronic
964635497 3:158853822-158853844 TTGGAAACTCAGAAGGAAGGTGG - Intergenic
964773477 3:160249849-160249871 CTGGAGACTCAGGAAGGGGAGGG - Intronic
965099398 3:164277427-164277449 ATACAGAGACAGAAGGAGGAGGG + Intergenic
967188817 3:186967764-186967786 ATGGAGGCCCAGAAAGGGGAAGG + Intronic
967940934 3:194766063-194766085 TTGGAGACTCAGATGCAGGGAGG + Intergenic
967954288 3:194865801-194865823 ACTGAGACTCAGAAGTAGGAAGG + Intergenic
968036583 3:195553055-195553077 CTGGAGTCTCAGAGGGAGGATGG - Intergenic
968124856 3:196151521-196151543 CTAGAGCCTCAGAAGGAGCATGG - Intergenic
968292861 3:197552470-197552492 ATGGAGACCCAGAACATGGAGGG - Intronic
968358484 3:198128001-198128023 AAGGAGATTCAGCAGGAAGATGG - Intergenic
968857548 4:3138394-3138416 TTGGAGACTCACAAGGCGGAAGG - Intronic
968992610 4:3924850-3924872 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
969121395 4:4913941-4913963 GTGCAGACTGAGCAGGAGGAGGG + Intergenic
969125790 4:4946844-4946866 ATGGAGATTCTGAAGCAGGATGG + Intergenic
969173291 4:5380849-5380871 ATTGAGACTCAGAGGAGGGAAGG + Intronic
969455481 4:7297523-7297545 AGGGAGACTCAGCAGGGGGCAGG - Intronic
969822741 4:9732772-9732794 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
969897174 4:10316274-10316296 TTGGAGACTCAGAAGGGTCATGG - Intergenic
970221422 4:13815836-13815858 ATGGAGACTCAGAAGGGTGTGGG - Intergenic
970273164 4:14368493-14368515 ATGGAGAGCCAGAAGGGGGATGG + Intergenic
970497914 4:16645807-16645829 ATTGAGACTTAGAAAGATGAAGG - Intronic
970815377 4:20150094-20150116 GTGGGGACACAAAAGGAGGAAGG - Intergenic
971393674 4:26209542-26209564 AGGGAGACAGGGAAGGAGGAAGG - Intronic
971393682 4:26209566-26209588 AGGGAGACAGGGAAGGAGGAAGG - Intronic
971394283 4:26214302-26214324 AAGGAGACAGAGAAGGAGGGAGG + Intronic
971417197 4:26442644-26442666 AGGAAGACTGAGAAGTAGGAAGG - Intergenic
971676425 4:29635354-29635376 CTGGAGACCCAGAAGGATGAGGG + Intergenic
971975679 4:33683311-33683333 TTGGAGACTCAGAATGGGGGAGG - Intergenic
972351936 4:38244187-38244209 ATGGAAACACAGCAGGATGAAGG - Intergenic
972390251 4:38607010-38607032 ATGGGGAGTCAGAAGGGGGATGG + Intergenic
972805009 4:42520538-42520560 ATGGAGAGCGAGAAGGTGGAGGG + Intronic
973192408 4:47400727-47400749 TTGGAGACTCAGAAGTGGGGAGG - Intronic
973251950 4:48069750-48069772 ACTGAGACATAGAAGGAGGAAGG - Intronic
973710821 4:53628962-53628984 ATGGAGGCTCAGAAGGGAAAGGG + Intronic
973840843 4:54858881-54858903 ATGGTAGCTCAGAAGGTGGAAGG + Intergenic
973996225 4:56462124-56462146 ATGAAGAATCAAAATGAGGACGG + Intergenic
974032797 4:56790990-56791012 ATGGAGACTCAGAAGAGGGAGGG - Intergenic
974347669 4:60702607-60702629 ATGTAGACTAATAGGGAGGAAGG + Intergenic
974837192 4:67265297-67265319 AGGGAGACACAGAAGGTGGGTGG - Intergenic
975290482 4:72672115-72672137 TTGGAGACTCAGAAGTGGGAGGG - Intergenic
975437445 4:74369307-74369329 TTAGAGACTCAGAAGGGGAAGGG - Intronic
975497856 4:75054327-75054349 ATGGATGTTCAGAAGGAGGATGG - Intergenic
975674998 4:76818572-76818594 ATGGAAACTAAAAAGGAGCAAGG - Intergenic
975802647 4:78077597-78077619 ATGGAGACTCGGAAGGGTGTGGG - Intronic
975905354 4:79204716-79204738 CTGGAGACTCAGAAGGGGAGTGG - Intergenic
976152516 4:82106392-82106414 ATGGTAACTCAGTAGAAGGAAGG + Intergenic
976171927 4:82313263-82313285 TTGGAGACTCAGAAGGGGAAGGG + Intergenic
977198948 4:94092490-94092512 TTGGAGACTCAGAAGGTGGGAGG + Intergenic
977249728 4:94676380-94676402 ATGGAGACTTGGAAGGGTGAAGG - Intergenic
977306593 4:95330971-95330993 ACAGAGACTCAGAAGGATGCAGG - Intronic
977509533 4:97945214-97945236 TTGGAGACTTAGAAAGGGGAGGG - Intronic
977608358 4:99005905-99005927 TTGGAGACTCAGAAAGGGGGAGG + Intronic
977707636 4:100088998-100089020 CTGGAGACTCAGAACGGGAAGGG - Intergenic
977910285 4:102526325-102526347 ATGGAGATTCAGAAAGGTGAGGG + Intronic
977974549 4:103249023-103249045 CTGGAGACTCAGAAGCAGGGAGG - Intergenic
978132286 4:105213691-105213713 ATGGAGACTCATAGGAAGGTGGG - Intronic
978383564 4:108156838-108156860 GTAGAGACTCAGAAGGGTGAGGG + Intronic
978913685 4:114097081-114097103 TTGGAGACTCAGAATGGGGAAGG - Intergenic
978994061 4:115128116-115128138 ATGGTGACTCAGAAGGGTTAGGG - Intergenic
979281463 4:118872827-118872849 ATGGAGACTCAAAAGGGGGAGGG - Intronic
979940921 4:126761916-126761938 ATGCACACACAGAAGTAGGAAGG + Intergenic
980784320 4:137532632-137532654 AAAGAGACGGAGAAGGAGGAAGG + Intergenic
980848136 4:138348774-138348796 TTAGAGACACAGAAGGAGGAAGG + Intergenic
980963800 4:139501419-139501441 TCAGAGACTCAGAAGGGGGAGGG + Intronic
981361589 4:143852065-143852087 TTGGAGACTCAGAAGGGGGAGGG - Intergenic
981372326 4:143973046-143973068 TTGGAGACTCAGAAGCGGGAGGG - Intergenic
981381410 4:144076245-144076267 TTGGAGACTCAGAAGCGGGTGGG - Intergenic
981730553 4:147892670-147892692 TTGGAGACTCAGAGGAAGGGGGG + Intronic
981783215 4:148448364-148448386 AGGGAGAGTCAGAAAGAGAAAGG + Intergenic
981889768 4:149721447-149721469 CTGGAGACTCAGAAGGGAGGAGG - Intergenic
981954602 4:150454737-150454759 TTGGAGACTTAGAAGGGAGAAGG - Intronic
981985256 4:150846551-150846573 ATGGAGACTCAGAACTCAGAAGG + Intronic
982188387 4:152826458-152826480 TTGGAGACTCAGAAGAGGGGAGG + Intronic
982446135 4:155492522-155492544 ATGAAGACATAGAAGGAAGATGG + Intergenic
982765029 4:159336328-159336350 TTGGAGACTCAGAAGGGGAAGGG - Intronic
982873458 4:160613761-160613783 ATGGATACTGAGAATGATGAGGG - Intergenic
982887672 4:160802469-160802491 TTGGAGACTCAGAATGGGGATGG + Intergenic
983400527 4:167259000-167259022 CTGGAGACTTAGAAGGGGGAGGG + Intergenic
983506969 4:168564016-168564038 ATGGAGACTGGGAAGGGTGAAGG - Intronic
984321770 4:178206677-178206699 TTGGAGACTCAGAAGGGGGAAGG + Intergenic
984613409 4:181867370-181867392 ATGGAGACTGAGGATGAGTATGG - Intergenic
984736478 4:183113268-183113290 ATGTAGAAACAGAGGGAGGAGGG + Intronic
984818922 4:183862762-183862784 AAGGAAACTCAGAAGAGGGAGGG + Intronic
985042839 4:185909366-185909388 TTGGAGACTCAGAAGGGCTAGGG + Intronic
985168478 4:187123229-187123251 AAGTAGACTGAGGAGGAGGAAGG - Intergenic
985440057 4:189976301-189976323 AAGGAGATTCAGCAGGAAGATGG + Intergenic
985686869 5:1286177-1286199 GTGGAGACTCACGAGGAGGGCGG - Intronic
985785204 5:1889713-1889735 CTGGAAACTCAGCAGGAGGGTGG - Intergenic
985944765 5:3170550-3170572 ATGGAGATTTAGGAGAAGGACGG - Intergenic
986435845 5:7730038-7730060 ATGGAGACTCCAAAGGGGGAAGG - Intronic
986465756 5:8021282-8021304 CTGGAGATTCAGAATGAGCAAGG - Intergenic
986539946 5:8834415-8834437 CTGGAGACTCAGAACAGGGAAGG + Intergenic
986687498 5:10287474-10287496 ATGGAGACTCAGAAGGGGGAGGG + Intronic
986943455 5:12985505-12985527 GAGTAGACTGAGAAGGAGGAGGG - Intergenic
986958341 5:13183381-13183403 ATGGAGATTCAGAGGGTGGGAGG - Intergenic
987005705 5:13707253-13707275 ATGGGGAGCCAGAAGGGGGATGG - Intronic
987081798 5:14431850-14431872 ATGGAGAATCAGCAAGAGGGTGG - Intronic
987212137 5:15693838-15693860 ATGGGGAGCCAGAAGGGGGATGG - Intronic
987241330 5:16003279-16003301 ACGGGGGCTCAGAATGAGGAAGG - Intergenic
987762321 5:22181375-22181397 AAGGAGACTGTAAAGGAGGATGG - Intronic
988113599 5:26854874-26854896 TTGGAAACTCAGAAGTAGGGAGG + Intergenic
988205339 5:28126516-28126538 ATGGAGAGCCAGAAGGGGGATGG - Intergenic
988222331 5:28364241-28364263 ATGGAGACTCAGAAGGGTAGGGG + Intergenic
988736639 5:34028633-34028655 AGGGAGAGAAAGAAGGAGGAAGG - Intronic
988861223 5:35281992-35282014 CTGGAGAGTCAGCAGGAGGAGGG + Intergenic
988889025 5:35594338-35594360 TTAGAGACTCAGAATGGGGAGGG - Intergenic
988979029 5:36545905-36545927 TTGGAGACTCAGAAGTAAGGAGG + Intergenic
989103852 5:37842577-37842599 ATGGTCCCTCAGAAGGAGGTGGG + Intergenic
989407748 5:41080303-41080325 TTGGAGACTCAGAAGTGGGGAGG - Intergenic
989443432 5:41500411-41500433 ATGGATACTCAGAAGGGTGAGGG + Intronic
989607539 5:43258928-43258950 TTGGAGACTTAGAAGGGGTAGGG - Intronic
990317858 5:54601077-54601099 ATGGACAGACAGAGGGAGGACGG - Intergenic
990427444 5:55700864-55700886 AAGGAGACAGAGAAGGAGGAGGG - Intronic
990663163 5:58041755-58041777 AAAGAGACTGAGAAGGAGCAGGG + Intergenic
991000261 5:61775655-61775677 ATGGAGACACGGAAGACGGAGGG + Intergenic
991063706 5:62403983-62404005 TTGGAGTCACAGAGGGAGGAAGG + Intronic
991325173 5:65423154-65423176 CTGGAGATTCAGAAGGGGGAAGG + Intronic
991411360 5:66348544-66348566 AAGCAGACTCAGGAGAAGGACGG + Intergenic
991897109 5:71414831-71414853 AAGGAGACTGTAAAGGAGGATGG - Intergenic
992073896 5:73173663-73173685 CTGGAGAACCATAAGGAGGAGGG - Exonic
992149756 5:73891386-73891408 AAAGAGACTGAGAAGGAGGGAGG - Intronic
992174873 5:74139899-74139921 ATGGGAGCTCAGAAGGAGCAGGG + Intergenic
992232566 5:74677857-74677879 GTGGAGACTCAGAAAGGGGAGGG - Intronic
992403615 5:76434347-76434369 TTGGAGACTCAGAAAGAGGAGGG - Intronic
992672752 5:79076138-79076160 ATGGGGAGCCAGAAGGGGGATGG + Intronic
992904619 5:81334108-81334130 ATGGGGAGCCAGAAGGAGGATGG - Intronic
993045212 5:82858632-82858654 AGGGAGACACTGAAGGAAGAAGG - Intergenic
993165064 5:84342401-84342423 ATGGAGACTCAGAAAGGTGGGGG + Intronic
993540051 5:89138136-89138158 TTGGAGACTCTGAAGGGGGAAGG - Intergenic
993628031 5:90249586-90249608 CTGGAGACTCAGAGGGGTGAGGG + Intergenic
993767588 5:91879907-91879929 ATGGAGACAGAGTAGAAGGATGG - Intergenic
994228350 5:97281788-97281810 ATGGAGACTCAGATGGGGGCAGG - Intergenic
994278781 5:97874401-97874423 AGGGAGAGTGAGAAGGAGAAAGG + Intergenic
994313544 5:98305497-98305519 TTGAAGACTCAGAAGTGGGAAGG + Intergenic
994388675 5:99163524-99163546 TTGGAGACTCAGAAATGGGAAGG + Intergenic
995318748 5:110806492-110806514 ATGGAAACTGAGAAGGAAAAGGG + Intergenic
995469968 5:112490955-112490977 ATAGAGACACAGAGGGAGGAAGG + Intergenic
996058719 5:119009237-119009259 ATGCTGACTCAGACTGAGGATGG + Intergenic
996410954 5:123158353-123158375 TTGGAGATGCAGAGGGAGGAAGG + Intronic
996620413 5:125495036-125495058 TTAGAGACTCAGAAGGGGAAGGG + Intergenic
997089896 5:130844438-130844460 CTGGAGACTCAGAAGAGGGGAGG + Intergenic
997716756 5:136048363-136048385 ATGGAGGGTCAGAAGAGGGAAGG - Intronic
997923096 5:138001502-138001524 ATGGAGCTTTAGAAGGAAGATGG - Intronic
998824059 5:146083332-146083354 ATAGAGACACAGAGGGAAGACGG - Intergenic
998934058 5:147215760-147215782 ATTGAGACTCAGGAGCATGAAGG - Intergenic
999115265 5:149157433-149157455 ATAAAGAATCAGAAGGAGGAAGG - Intronic
999320807 5:150613952-150613974 ATGGGGAATCAGAAGGAGGCTGG + Intronic
999575408 5:152971227-152971249 TTGGAAACTCAGAAGGAGGAGGG + Intergenic
999685161 5:154096214-154096236 ATGGTGACTCAGCAGGAGGCAGG - Intronic
999797406 5:155001467-155001489 ATAGAGACACAGAGGGAAGATGG + Intergenic
999884434 5:155905414-155905436 AAGGAGGCTTAGAAAGAGGATGG + Intronic
1000112343 5:158120931-158120953 AAGGTGACTCAGAAGGAATAGGG + Intergenic
1000337242 5:160250945-160250967 ATGGAGGCTCAGAGAGAGGTTGG + Intergenic
1000383678 5:160652142-160652164 AAGGAGACACAGCAGGAGGAAGG - Intronic
1000641073 5:163702265-163702287 TTAGAGACTCAGAAGGGTGAAGG - Intergenic
1000658892 5:163915412-163915434 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
1000755759 5:165157562-165157584 GTGGAGACTGAGAAGTAGAAGGG - Intergenic
1001111563 5:168900937-168900959 ATGGAGCCTCAGAAGCGTGAGGG + Intronic
1001214917 5:169846855-169846877 TTGGAGACTCAGAAGGGGGAGGG - Intronic
1001427018 5:171629392-171629414 ATGGAGGCTCAGAGAGAGGGAGG + Intergenic
1001760882 5:174207150-174207172 TTGGAAACTCAAAAGGGGGAGGG + Intronic
1001895345 5:175374601-175374623 TTGGAGACTCAGAAGGAGGGAGG - Intergenic
1002899490 6:1399132-1399154 ATGGAGACAGAGAAGAAGGAGGG + Intergenic
1002905736 6:1447590-1447612 CTGGAGACTCAGAAGGGGGGAGG - Intergenic
1002996931 6:2295278-2295300 TTGGAGACTGACAAGGGGGAGGG + Intergenic
1003292699 6:4793628-4793650 AGGGAGACTTAGAAGGAAGCCGG + Intronic
1003315853 6:5011350-5011372 AAAGAGACACAGCAGGAGGAAGG + Intergenic
1003460232 6:6321864-6321886 TTGGAGATGCAGAGGGAGGAGGG - Intergenic
1003637519 6:7846510-7846532 GGGGAAACACAGAAGGAGGAAGG + Intronic
1003652676 6:7975819-7975841 ATGTAGACAGAGAAGCAGGATGG + Intronic
1003967379 6:11266020-11266042 ATGGAGACTTGGAAGGGAGAGGG + Intronic
1004170671 6:13293323-13293345 TTGGGGACTCAGAAGGGGGAGGG + Intronic
1004180161 6:13374406-13374428 AAGGAGACTGAGCAGGAGAATGG - Intronic
1004478836 6:15999820-15999842 ACTGAGACTCAGAAGGATAAAGG + Intergenic
1004675572 6:17838760-17838782 ATGGAGACTTGGAAGGGTGAGGG + Intronic
1004984079 6:21059917-21059939 GTGAAGACTCAGAAGGGGGAGGG - Intronic
1004985277 6:21074974-21074996 TTGGAGACTCAGAAGTGGGGAGG - Intronic
1005046771 6:21650684-21650706 ATGGAGACACAGCAGGGGGTGGG + Intergenic
1005088321 6:22029839-22029861 ATGGAGACTGAGAAGGAGAGAGG + Intergenic
1005285184 6:24318558-24318580 TTAGAGACTCAGAAGGATGCTGG - Intronic
1005844270 6:29765490-29765512 ATGGAGTGTCTGAGGGAGGAGGG - Intergenic
1005849507 6:29810917-29810939 ATGGAGACCCAGAAGGGTAAGGG + Intergenic
1005856375 6:29866282-29866304 ATGGAGTGTCTGAGGGAGGAGGG - Intergenic
1006241288 6:32681328-32681350 TTGGAGACTCAGAAGAGGGGAGG - Intergenic
1006301754 6:33197323-33197345 ATGGAGACACAGAAGAAGGAAGG + Intronic
1006361027 6:33587158-33587180 ACTGAGGCTCAGAAAGAGGAAGG - Intergenic
1006670384 6:35726639-35726661 ATAGGGACTCAGAAGAAAGAAGG - Intronic
1006815989 6:36850353-36850375 GTGGAGGCGCAGCAGGAGGAAGG - Intergenic
1007040357 6:38715747-38715769 TCGGAGACTCAGAAGGGGAAGGG + Intronic
1007073451 6:39052450-39052472 AAGGCCTCTCAGAAGGAGGAAGG - Intronic
1007099042 6:39231940-39231962 ATGGAGAGCAAGAAGGAAGAAGG - Intergenic
1007350064 6:41265870-41265892 ATAGAGACTCAGAAGAGTGAGGG + Intergenic
1008024083 6:46614384-46614406 ATGGAAACTCGGAAGGACTAGGG - Intronic
1008117523 6:47569240-47569262 ATGGAAACTCAGAAGAATGGTGG + Intronic
1008921738 6:56850098-56850120 ATGGAGACTGAGAGTGAGCAGGG - Intronic
1009271374 6:61619262-61619284 TTAGAGACTCAGAAGGGGGAGGG - Intergenic
1009278340 6:61714881-61714903 ATGGAGACTCAGAAGAGTGGGGG + Intronic
1009347916 6:62639554-62639576 ATGGAGACTCAGACCGTGTAGGG - Intergenic
1009925931 6:70120712-70120734 ATGGATACTTAGAAGCAGGCTGG - Intronic
1010028374 6:71245743-71245765 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
1010452037 6:76014331-76014353 TTTGAAACTCAGAGGGAGGAAGG + Intronic
1010628467 6:78168273-78168295 ATGGGGAACCAGAAGGGGGATGG + Intergenic
1010815465 6:80353062-80353084 ATGGAGACTCAGAGAGGAGAGGG - Intergenic
1010828423 6:80501167-80501189 ATAGAGACTCCGAAGGATGAGGG + Intergenic
1010887374 6:81261575-81261597 ATGGAGGTTTAGGAGGAGGAGGG + Intergenic
1010977008 6:82326572-82326594 TTGGAGACTCAGAAGAAAGGAGG - Intergenic
1011553799 6:88554007-88554029 TTGGAGTCTCAGATGCAGGACGG - Intergenic
1012029560 6:94041066-94041088 CTGGAGACTCAGAAGTGGGGAGG - Intergenic
1012635224 6:101529772-101529794 ATGGGAATTCAGAAGAAGGATGG + Intronic
1012691550 6:102319321-102319343 TTGGAGGCTCAGAAGAAGAAAGG + Intergenic
1012729698 6:102866682-102866704 TTGGAGACTCAAAAGGGGAAAGG + Intergenic
1012823142 6:104114154-104114176 ATGGAAACTCAGAATGATGAGGG - Intergenic
1012902344 6:105020708-105020730 ATAGAGACTCAGAAGGGTGAGGG - Intronic
1013380629 6:109566704-109566726 CTGGAGACTCAGAAGGGAGCAGG + Intronic
1013496156 6:110699563-110699585 TTGGAGATTCAGAAGAAGGGAGG + Intronic
1013508649 6:110824407-110824429 CTGGAGACTCAGAAAAGGGAGGG + Intronic
1013837047 6:114345010-114345032 AAGATGACTGAGAAGGAGGATGG + Intergenic
1013954208 6:115821574-115821596 TTAGAGACTCAGAAGAAGAAGGG + Intergenic
1014088969 6:117381394-117381416 TTGGAGACTCAGAAGGAGGGAGG - Intronic
1014092627 6:117421414-117421436 TTGGAGACTCAGAAGGGGGAGGG - Intronic
1014393648 6:120896133-120896155 TTAGAGACTCAGAAGGGGGAGGG + Intergenic
1015210663 6:130694865-130694887 ATGGAGAAGCAGCAGCAGGAAGG + Intergenic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1015330889 6:131977890-131977912 CTGGGGGCTCAGAAGGAAGAGGG - Intergenic
1015365920 6:132398052-132398074 ATAGAGACTCAAAAGGGTGAAGG - Intronic
1015483941 6:133746765-133746787 ATGAAGACTCAGAATTGGGAGGG - Intergenic
1015553005 6:134431619-134431641 ATAGGGAGTAAGAAGGAGGACGG + Intergenic
1015636266 6:135277801-135277823 TTGGAGACTCAGAAGGGGGAAGG + Intergenic
1015812878 6:137178921-137178943 ATGGAGACACAGTAGGTGCAGGG + Intergenic
1015916506 6:138222872-138222894 CTGGAGACTCAGAATGGGGGAGG - Intronic
1016110328 6:140215564-140215586 ATGGAGACTCAGAAGTAAGAGGG - Intergenic
1016150628 6:140737554-140737576 TTGGAGACTCAGAAAGGAGAGGG - Intergenic
1016172050 6:141030068-141030090 TTGGAGGCTGAGAAGGAGAATGG - Intergenic
1016379174 6:143456176-143456198 ATTTAGACACAGAGGGAGGAAGG + Intronic
1016385971 6:143531243-143531265 TTGGAGACTCAGAAAGGGGAGGG + Intergenic
1016619883 6:146096362-146096384 ATGGAGCCTAAGTAAGAGGAAGG + Intronic
1016693040 6:146961360-146961382 CTGGAGACTCAGAAGGGTAAGGG + Intergenic
1017047157 6:150357439-150357461 ATGTAGACTCAGAAGTTAGATGG + Intergenic
1017055392 6:150431432-150431454 ATGTAGAACCAGAAGCAGGAGGG + Intergenic
1017229154 6:152053401-152053423 AGGGAGAGACAGAAGGAGGAAGG - Intronic
1017272315 6:152522213-152522235 TTGGAGACTCAGAAGGATGAGGG - Intronic
1017375630 6:153764496-153764518 TTAGAGGCTCAGAAGGAGCAGGG + Intergenic
1017572900 6:155766529-155766551 AGGGAGAGACCGAAGGAGGAAGG - Intergenic
1017616578 6:156252583-156252605 ATGGAGATTTGGAAGGATGAGGG - Intergenic
1017938360 6:159027334-159027356 TTGGAGACTCAGAATGGGGGAGG + Intergenic
1017980135 6:159394173-159394195 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1018012675 6:159685966-159685988 ATGGAGGCGTAGAAGAAGGAGGG - Intronic
1019098861 6:169610880-169610902 TTGGAGACTCACAAGGGGGCAGG + Intronic
1019192591 6:170261851-170261873 ATGGAGAATCAGCAGGTGCACGG + Intergenic
1019388008 7:769387-769409 ATGGAGACTTACAGGGAGGCGGG + Intronic
1019391927 7:793180-793202 GTGGAGACTCAGAAGGGTGAAGG + Intergenic
1020116703 7:5480203-5480225 ACGGAAACCCAGGAGGAGGAAGG + Intronic
1020315256 7:6901206-6901228 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1020966944 7:14882596-14882618 ATAGAGACTCAGAAGGGAGAAGG - Intronic
1020970252 7:14928831-14928853 ATGGAGACTCAGATGGATGAGGG - Intronic
1021280259 7:18708282-18708304 ATGGAGAAAAAGAGGGAGGAAGG + Intronic
1021390524 7:20087246-20087268 ATTGACACTAAGAAGTAGGAAGG + Intergenic
1021416529 7:20392681-20392703 ATGGAGACTTGGAAGGGTGAGGG - Intronic
1021466500 7:20949987-20950009 TTGGAGACTCAGAAGGTGGGAGG + Intergenic
1021873132 7:25023194-25023216 TTGGAGACTCTGAAGGGGGAGGG - Intergenic
1021939999 7:25669682-25669704 ATGGAGACTCGGGTGGGGGAAGG + Intergenic
1021965561 7:25915009-25915031 AAGGAGACCCAGAAGGAGTGGGG - Intergenic
1022751417 7:33230577-33230599 TTGCAGACTCAGAAGCAGGCAGG - Intronic
1022992760 7:35724910-35724932 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1023168762 7:37369901-37369923 AAGGAGGATCAGAAGGAGTAGGG - Intronic
1024217119 7:47256928-47256950 ATGGAGACGGTGAGGGAGGAGGG + Intergenic
1024272458 7:47652864-47652886 AGGGAGACTCAGAAGGGTGGAGG + Intergenic
1024863499 7:53874939-53874961 CTGGGGACTCAGAGGCAGGAAGG + Intergenic
1024979719 7:55147080-55147102 CTGGAGACTCAGAAGCATGTAGG - Intronic
1026111066 7:67459302-67459324 ATGGGGATCCAGAAGGGGGATGG + Intergenic
1026150852 7:67787117-67787139 AGTGAGACTCTGAAGAAGGAAGG - Intergenic
1026272018 7:68844936-68844958 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
1026289083 7:68989791-68989813 ATGGAGACACAGATGGAAGAAGG - Intergenic
1026313925 7:69211683-69211705 ATGGGGAGCCAGAAGGAGGGTGG - Intergenic
1026680224 7:72461027-72461049 ATGGAGAGAAGGAAGGAGGAAGG - Intergenic
1026837259 7:73647375-73647397 AGGGAGAGCCAGAGGGAGGAAGG + Intergenic
1026935172 7:74250599-74250621 CTGGAGACGAAGGAGGAGGATGG - Intronic
1027408103 7:77884388-77884410 ATGGAGACTCAGAAGGGGTAGGG - Intronic
1027528723 7:79303145-79303167 TTGGAGACTCAGAGGGTGGAAGG + Intronic
1027609709 7:80345459-80345481 ATGGAGACTCAGAAGGTGGAGGG + Intergenic
1027823996 7:83087287-83087309 TTGGAGACTCAGAAGCAGGGAGG + Intronic
1027833201 7:83206906-83206928 AGGGAGAGTGAGAAGGAGCAAGG - Intergenic
1027936769 7:84615592-84615614 ATGGGAAATCACAAGGAGGAAGG + Intergenic
1028123910 7:87089354-87089376 ATGGAGACTCAGAAGGGTGAGGG + Intergenic
1028308381 7:89295985-89296007 TTAGAGACTCGGAAGGAGTAGGG + Intronic
1028396104 7:90369994-90370016 TTGGAGACTCAGAGGGAGGAAGG + Intronic
1028454940 7:91028051-91028073 CTGGAGACTCAGAAGCAGGAAGG - Intronic
1028505478 7:91565919-91565941 AGCCAGACTGAGAAGGAGGAGGG - Intergenic
1028524961 7:91773787-91773809 ATGGATACTAAGAAAAAGGAAGG - Intronic
1028607593 7:92671969-92671991 TTGGAGACTCAGAAAGGGGGAGG + Intronic
1028870405 7:95765361-95765383 CTGGAAACTAAGAGGGAGGAGGG + Intergenic
1028967498 7:96818269-96818291 TTGGAGACTCAGAAGAGGGGTGG - Intergenic
1029337769 7:99916929-99916951 ATGGAGCATGGGAAGGAGGATGG - Intronic
1029611601 7:101629567-101629589 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
1029653973 7:101912244-101912266 ATGGAGATAGAGGAGGAGGAGGG - Intronic
1029928469 7:104344418-104344440 TTGGAGATTCAGAAGGGGAAGGG - Intronic
1030014200 7:105201975-105201997 ATGAAGAGTAAGAGGGAGGATGG + Intronic
1030145755 7:106353161-106353183 CTGGAGACTCAGAAGTGGGGAGG - Intergenic
1030360253 7:108588037-108588059 ATGGAGAGTGTGAGGGAGGAGGG - Intergenic
1030401495 7:109057235-109057257 CTGGAGACTCAGAAGGAGAGAGG - Intergenic
1030749063 7:113207210-113207232 AAGGAGACTCAGCAGAAGAAAGG - Intergenic
1030942417 7:115670499-115670521 ATAGTTACACAGAAGGAGGAAGG + Intergenic
1030991544 7:116307143-116307165 ATGGAGACTTAGAAGGGTGATGG + Intronic
1031003674 7:116447250-116447272 TTGGAGACTCAGAAGAGGGAGGG + Intronic
1031626992 7:124003591-124003613 ATCAAGATTCAGGAGGAGGATGG - Intergenic
1031656608 7:124363917-124363939 TTAGAGACTCATAAGGGGGAGGG - Intergenic
1031674464 7:124591518-124591540 TTAGAGACTCATAAGAAGGAAGG + Intergenic
1031714870 7:125096541-125096563 CTGGAGATTCAGAAGGAGGAGGG - Intergenic
1033647037 7:143313091-143313113 GTAGAGGCTCAGAAGGAGGGAGG + Intergenic
1033656978 7:143381288-143381310 AGGGACACACGGAAGGAGGAGGG - Exonic
1033754250 7:144384909-144384931 ATGGAAACCCAGAAGGAGAGAGG + Intergenic
1033984362 7:147205243-147205265 CTGGAGACTTAGAAGGAGGGAGG - Intronic
1034071701 7:148192259-148192281 GTGGAGACTCAGAAGGGTGTAGG - Intronic
1034277269 7:149829401-149829423 AGGGGGACACAGGAGGAGGAGGG - Intergenic
1034306763 7:150049493-150049515 ATGGAAACCCGGAAGGAGCAGGG - Intergenic
1034800081 7:154051149-154051171 ATGGAAACCCGGAAGGAGCAGGG + Intronic
1034922092 7:155091660-155091682 ATTGAGGCTGAGAAGGGGGAAGG + Intergenic
1035130414 7:156647352-156647374 TTGGAGACTCAGGAGGCGGAGGG - Intronic
1035138666 7:156734479-156734501 ATGGAGAGTCAGAAGGGAGAGGG + Intronic
1035239565 7:157520926-157520948 AAGGAGACTGGGGAGGAGGAGGG + Intergenic
1035343219 7:158178354-158178376 TTGGAGACTCAGAAGCGGGAGGG - Intronic
1035522910 8:289833-289855 ATGGAGACTCTGAAAGAGGGAGG - Intergenic
1035543755 8:462732-462754 TTGGAGACTCAGAAGAGGGAAGG + Intronic
1036125976 8:6062270-6062292 CTGGAGACACAGAAAGAGAAAGG + Intergenic
1036576805 8:10035152-10035174 CTGGAGACTCAGAAGGGGGAAGG + Intergenic
1036658172 8:10691015-10691037 CTGGTGACTCAGAAAGTGGAGGG - Intronic
1036744064 8:11391512-11391534 AAGGAGTTCCAGAAGGAGGACGG - Intronic
1036783212 8:11664785-11664807 TTAGAGACTCAGAAGAAAGAGGG - Intergenic
1036986961 8:13543828-13543850 TTGGAGACTCAGAAGAGGGGAGG + Intergenic
1037250992 8:16894065-16894087 CTGGAGACTCAGAAGGGAGGAGG - Intergenic
1038324819 8:26564927-26564949 TTGGAGACTCAGAAGAAGGAGGG - Intronic
1038399622 8:27273117-27273139 ATGGTGTCTCAGAAAGAGGAGGG + Intergenic
1038896888 8:31793882-31793904 ATGGAGAGATGGAAGGAGGAAGG - Intronic
1038907606 8:31923866-31923888 ATGGAGACTTAGAGGGGTGAGGG - Intronic
1038932233 8:32206791-32206813 CTGGAGACTCAGAAGGGTGGAGG - Intronic
1039098347 8:33911922-33911944 ATGAAGACTCAGAAGGGTGAGGG + Intergenic
1039201661 8:35101341-35101363 TTAGAGCCTCAGAAGGAGGACGG - Intergenic
1039291082 8:36095126-36095148 AGGGGGACTCAGGAGGAGGAAGG + Intergenic
1039693526 8:39885331-39885353 ATGGACAATCAGCAGGAGGTGGG - Intergenic
1039945647 8:42126766-42126788 TTGGAGACAGAGAAGGAGGGAGG - Intergenic
1040087320 8:43358137-43358159 TTGGAGACTCAGAAGAAGGAAGG - Intergenic
1040393889 8:46976123-46976145 ATGGAGACGCAGCGGGTGGAAGG + Intergenic
1040405186 8:47094743-47094765 TTGGAGACTCAGAAGAAGAAAGG + Intergenic
1040690960 8:49937872-49937894 AAAGGAACTCAGAAGGAGGAGGG - Intronic
1040719859 8:50306051-50306073 TTAGAGACTCAGAAGGGGGAGGG - Intronic
1040970397 8:53130002-53130024 TTGGAGACTCAGAAACAGGAGGG - Intergenic
1041319254 8:56596363-56596385 TAGGAGACTCAGAAGGTGGGAGG - Intergenic
1041341611 8:56852137-56852159 ATGGAGACTGGGCAGCAGGAAGG + Intergenic
1041648489 8:60277885-60277907 AAGGGGAATCTGAAGGAGGAAGG + Intronic
1041744988 8:61198722-61198744 TTGGAGACTTAGAAGAAGGGAGG - Intronic
1041893551 8:62898545-62898567 TTGGAGACTCAGAAGGGAGGAGG + Intronic
1041918302 8:63157864-63157886 ATGGGGAGTCAGAAAGGGGATGG + Intergenic
1041937351 8:63348477-63348499 TTGGAGACTCAGAAGAGGCAAGG - Intergenic
1042159217 8:65875106-65875128 ATGGGGATCCAGAAGCAGGATGG + Intergenic
1042179067 8:66066709-66066731 TCGGAGACTCAGAAGGGGGAGGG + Intronic
1042397696 8:68311080-68311102 AAGGAGACAGGGAAGGAGGAAGG - Intronic
1042397832 8:68311941-68311963 AGGGAGACAGGGAAGGAGGAAGG - Intronic
1042784496 8:72533329-72533351 TTGGAGACTCAGAAGGGGGAAGG - Intergenic
1042942189 8:74118755-74118777 AAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1043355621 8:79408858-79408880 TTGGAGACTCAGAAGGGGAGAGG - Intergenic
1043367596 8:79553275-79553297 TTGGAGACTCAGAAGGGGAAGGG + Intergenic
1043412981 8:80018956-80018978 ATGGAGACAGAGTAGAAGGATGG + Intronic
1043736315 8:83749771-83749793 TTGGAGACTCAGAAGGGTAAAGG - Intergenic
1044471592 8:92575511-92575533 ATGGAGACAATGAAGGAAGAAGG - Intergenic
1044661534 8:94596140-94596162 ATTCAGATTCAGAAGGTGGAAGG + Intergenic
1044918700 8:97145189-97145211 TTGGAGACTCAGAAGCAGGGAGG - Intronic
1045054901 8:98360381-98360403 ATGGAGACACAGAGGGAAGAAGG - Intergenic
1045065223 8:98438063-98438085 TTGGAGGCTCAGAAGGAGGATGG + Intronic
1045090187 8:98733982-98734004 ATGGAGACTCACAATCATGACGG + Intronic
1045325839 8:101117095-101117117 ATGGAAGCTGAGAAGGAGGTCGG - Intergenic
1045355920 8:101388996-101389018 ATGGGGACAGAGAAGGAGGATGG - Intergenic
1046174683 8:110560050-110560072 ATGGGGAGCCAGAAGGTGGAGGG + Intergenic
1046198968 8:110897102-110897124 ATAGAGACTCAGTAGCAGGCAGG + Intergenic
1046232951 8:111381475-111381497 TTGGAGACTCAGAAGGGGGCAGG - Intergenic
1046238964 8:111465187-111465209 TTAGAGACTCAGAATGTGGAGGG + Intergenic
1046297661 8:112242989-112243011 ATGGATACTTAGAATTAGGAGGG + Intronic
1046509897 8:115188966-115188988 AGAGAGAATCAGAAGGATGAAGG - Intergenic
1046779622 8:118201233-118201255 ATGCAGAGCCAGAAGGAGGCTGG - Intronic
1046870654 8:119202530-119202552 TTAGAGTCTCAGAAGGAGAAGGG - Intronic
1046927890 8:119812478-119812500 TTGGAGACTCAGAAGCGGGGAGG - Intronic
1046975836 8:120276345-120276367 TTGGAGACTCAGAGTGGGGAGGG + Intronic
1047102531 8:121694111-121694133 ATGGAGACTTTGAAGGGTGAGGG + Intergenic
1047106078 8:121731900-121731922 TTGGAGACTCAGAAGGAAGAGGG - Intergenic
1047633817 8:126737490-126737512 TTAGAGACTCAGAAGGAGAAGGG - Intergenic
1047889185 8:129288458-129288480 ATAAAGACTCAGAAGAGGGAGGG + Intergenic
1047893787 8:129342995-129343017 ATGGAGACACAGTAGGAAGGAGG + Intergenic
1048039210 8:130709173-130709195 ATGGAGAATTAGAATGAGGAGGG + Intergenic
1048714330 8:137251155-137251177 AGGGAGACTCAGAAGGGTGCAGG + Intergenic
1049101102 8:140579712-140579734 ATAGAGACTGAGAAGGAGAACGG + Intronic
1049569558 8:143362793-143362815 ATGGAGGCTCAGAAGACCGAAGG - Intergenic
1050286520 9:4108401-4108423 ATGGAAACTCTGAGGGAAGAAGG + Intronic
1050301132 9:4260010-4260032 ATGGAAACACAGAGGGAGAAAGG + Intronic
1050349958 9:4731850-4731872 AAGTAGACTGAGGAGGAGGAGGG - Intronic
1050475621 9:6037824-6037846 TTGGAGACTCAGAAGAATGTAGG - Intergenic
1050500619 9:6294298-6294320 TTGGAGATTCAGAAAGAGGAAGG - Intergenic
1051099715 9:13507029-13507051 ATCAAGACTCACAAGGAGGCTGG + Intergenic
1052177931 9:25486923-25486945 AGGGAGACTCTGAAGAAGGTTGG + Intergenic
1052551488 9:29955834-29955856 ATGGAGACTCAGAATGGGGAGGG - Intergenic
1052599408 9:30605285-30605307 CTGGAGACTGAGAAGCAGGGAGG - Intergenic
1052736231 9:32345252-32345274 ATGGGGTTTGAGAAGGAGGAGGG - Intergenic
1052768674 9:32667751-32667773 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
1052975182 9:34405001-34405023 CTGGAGCCTGAGGAGGAGGATGG + Intronic
1053107380 9:35422982-35423004 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
1053437303 9:38084554-38084576 ATGGGGATTAGGAAGGAGGAAGG + Intergenic
1053487411 9:38470431-38470453 CTGGAGACTCAGAAGGGGGAAGG - Intergenic
1053524852 9:38818032-38818054 CTGGAGACTCAGAAGCGGGAGGG - Intergenic
1053525064 9:38820818-38820840 TTGGAGACTCAGAAGGGGAAGGG - Intergenic
1053532198 9:38893854-38893876 TTGGAGACTCAGAAGCAGGAAGG + Intergenic
1053672999 9:40388733-40388755 TTGGAGACTCAGAGCGGGGAGGG - Intergenic
1053750139 9:41245072-41245094 ATGGAGACTCAGCAGGGTGAGGG - Intergenic
1053922809 9:43015102-43015124 TTGGAGACTCAGAGCGGGGAGGG - Intergenic
1054197086 9:62042448-62042470 CTGGAGACTCAGAAGCGGGAGGG - Intergenic
1054197295 9:62045240-62045262 TTGGAGACTCAGAAGGGGAAGGG - Intergenic
1054204421 9:62118263-62118285 TTGGAGACTCAGAAGCAGGAAGG + Intergenic
1054255638 9:62809411-62809433 ATGGAGACTCAGCAGGGTGAGGG - Intergenic
1054335673 9:63806196-63806218 ATGGAGACTCAGCAGGGTGAGGG + Intergenic
1054384108 9:64528799-64528821 TTGGAGACTCAGAGCGGGGAGGG - Intergenic
1054511626 9:65987550-65987572 TTGGAGACTCAGAGCGGGGAGGG + Intergenic
1054633940 9:67470101-67470123 TTGGAGACTCAGAAGCAGGAAGG - Intergenic
1054641114 9:67543442-67543464 TTGGAGACTCAGAAGGGGAAGGG + Intergenic
1054641322 9:67546246-67546268 CTGGAGACTCAGAAGCGGGAGGG + Intergenic
1054741823 9:68813842-68813864 ATCGAGTCTCAGAGGGAGCATGG + Intronic
1054880347 9:70138061-70138083 GTGGAGACTTAGAAGGGTGAGGG - Intronic
1055053379 9:72001290-72001312 AAGGGGATGCAGAAGGAGGATGG + Intergenic
1055340091 9:75272403-75272425 TTGGAAACTCAGAAGGGGGAAGG - Intergenic
1056327355 9:85490915-85490937 ATGGGGAGCCAGAAGGAGGATGG - Intergenic
1056387809 9:86113490-86113512 ATGGAAACTCAAGAGGAAGATGG - Intergenic
1056545054 9:87606478-87606500 AGGGAGAGACAGAGGGAGGAAGG - Intronic
1056812059 9:89772553-89772575 AGAGAGACTTTGAAGGAGGAGGG - Intergenic
1056871905 9:90289626-90289648 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1057076142 9:92139113-92139135 AAGGAGACAGAGAAGGAGCAGGG - Intergenic
1057339816 9:94190062-94190084 ATGGAAAATGAGAAGCAGGAGGG - Intergenic
1057388323 9:94623387-94623409 AGGGAGGCTCAGAAAGAGCAGGG - Intronic
1057936613 9:99244930-99244952 AGGGAGACTGGGAAGAAGGAAGG + Intergenic
1058030011 9:100185707-100185729 TTGGGGACTCAGAAAGGGGAAGG - Intronic
1058236598 9:102498123-102498145 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
1058276494 9:103048039-103048061 TTAGAGAATCAGAAGGGGGAGGG + Intergenic
1058348043 9:103988003-103988025 TTGGAGACTCAGAAGTAGGTAGG + Intergenic
1058404869 9:104661433-104661455 ATGGAGCCTCACATGAAGGAAGG + Intergenic
1058463933 9:105209617-105209639 ATGGAGACTCAGAAGGAGAAGGG - Intergenic
1058587462 9:106525602-106525624 CTGGAGACTCAGAAGGGGGTGGG + Intergenic
1058876616 9:109250214-109250236 ACGGAGGCCCAGAAGTAGGAAGG + Intronic
1058935139 9:109763192-109763214 AGGGAAACTCAGAGGGCGGAGGG + Intronic
1059491691 9:114673061-114673083 CTGGACTCTCAGAAGGACGAAGG + Intergenic
1059643904 9:116245144-116245166 ATGGACACTCAGAAGGGTGGGGG + Intronic
1059740216 9:117142854-117142876 CTGGAGACACAGATGGAGGGAGG - Intronic
1059828225 9:118058118-118058140 ATGGAGACTCAGAAGCCTGAGGG - Intergenic
1059990082 9:119856775-119856797 ATGGAGACTGGGAAGGGTGAAGG - Intergenic
1060204602 9:121675112-121675134 TTGGCGACTCAGCAGGAAGATGG - Intronic
1060269755 9:122132097-122132119 ACGGAGGCTCAGAGAGAGGAAGG - Intergenic
1060333448 9:122698167-122698189 TTGGAGACTCCGAAGTGGGAAGG + Intergenic
1060338276 9:122748690-122748712 ATAGAGACTCAGAAGAAGTGGGG - Intergenic
1061074805 9:128334607-128334629 ATGGGGACTCAGAGAGGGGAAGG - Intergenic
1061156189 9:128863197-128863219 AAGTAGACACACAAGGAGGAGGG + Intronic
1061727718 9:132590482-132590504 ATGGAGACAGAGGAGGAGGAGGG - Intergenic
1062092580 9:134686221-134686243 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1062194306 9:135264422-135264444 AAGGAGACTCAGGATTAGGAGGG + Intergenic
1062638406 9:137503569-137503591 AAGGAGAAGGAGAAGGAGGAGGG + Intronic
1203371924 Un_KI270442v1:315169-315191 ATGGAGACTCAGCAGGGTGAGGG + Intergenic
1203375609 Un_KI270442v1:373678-373700 ATGGAGACTCGGCAGGGTGAGGG + Intergenic
1185499060 X:583999-584021 AGGGAGACAGAGGAGGAGGAGGG + Intergenic
1185859566 X:3564982-3565004 TTGGAGACTCCGAAGTGGGAGGG + Intergenic
1185926441 X:4152321-4152343 TTGGACACTCAGAAGGGGGAGGG - Intergenic
1185998961 X:4987314-4987336 TTGGAGACTCAGAAGCAGGAAGG + Intergenic
1186122544 X:6379589-6379611 CTGGAGACTCAGAAGTTGGGAGG - Intergenic
1186826308 X:13343548-13343570 TTGGAGACTCAGAAGGGAGGAGG - Intergenic
1186835861 X:13437159-13437181 TTGGAGACTCAGAAGGGTGAGGG + Intergenic
1186849892 X:13569824-13569846 AGGGGGGCTCAGGAGGAGGAAGG + Exonic
1187080287 X:15979042-15979064 CTGGAGACTCAGAAAGGGGGAGG + Intergenic
1187096197 X:16151024-16151046 ATGGAGACAAAGCAGGAGGCTGG + Intronic
1187097280 X:16161906-16161928 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1187138524 X:16571154-16571176 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1187206523 X:17186911-17186933 TTGGAGACTCAGAAGCAGGGAGG + Intergenic
1187435537 X:19265404-19265426 TCAGAGACTCAGAAGGTGGAGGG - Intergenic
1187586657 X:20669993-20670015 TTGGATACTCAGAAGGGGGAAGG - Intergenic
1187716601 X:22108342-22108364 TTGGAGACTCAGAAGCAGGGAGG + Intronic
1187834710 X:23420146-23420168 GTGGAGACTCAGAAGTATGGGGG + Intergenic
1188009536 X:25041592-25041614 ATGGAGACACAGAGAGAGGATGG - Intergenic
1188158741 X:26774966-26774988 ATGGAGACTCAGAAAGGGGAAGG + Intergenic
1188181439 X:27060815-27060837 ATGGAGGCTCAGAAGGGTGGAGG - Intergenic
1188206828 X:27370206-27370228 TTGGAGACTCAGAAACAGAAGGG + Intergenic
1188303982 X:28539840-28539862 ATGCAGACACAGAAGGAAGATGG + Intergenic
1188607450 X:32049527-32049549 ATGGAGACTCTGAAGGGATAAGG - Intronic
1188747390 X:33862798-33862820 ATGGAGACAGAGCAGAAGGATGG - Intergenic
1189129401 X:38482416-38482438 ATGGAGACTCAGAGGAATGCTGG - Intronic
1189175570 X:38953866-38953888 ATGGAGGCTCAGAAGGATCAAGG + Intergenic
1189203767 X:39220193-39220215 ACGCAGACTCAGAAGAAAGATGG - Intergenic
1189237580 X:39499558-39499580 TTGGAGACTCAGAAGTGGGGAGG - Intergenic
1189494377 X:41495827-41495849 ATGGAAATTCAGAAGGGTGAGGG - Intergenic
1190056340 X:47183215-47183237 ATGGAGACTCAAAAGGTGGAGGG + Intronic
1190248135 X:48704326-48704348 ATGGAGACTAGGAAGGATGTGGG + Intronic
1190435446 X:50420011-50420033 ACTGAGACTCAGAAAGAGGTAGG - Intronic
1190681409 X:52830047-52830069 AGGGAGACTCAGAGGGAGAAGGG - Intergenic
1190998502 X:55636087-55636109 AGGGAGACTCAGAGGGAGAAGGG - Intergenic
1191673177 X:63768135-63768157 TTGGAGACTCAGAAGGGGAAGGG - Intronic
1191834546 X:65449839-65449861 TTGGAGACTCAGAAGCATGAGGG + Intronic
1191974902 X:66861309-66861331 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
1192049627 X:67712212-67712234 ATTGAGACCCAGAAGGGGAAGGG - Intronic
1192058408 X:67797531-67797553 TTGGAGACTAAGAAGGGGGAGGG + Intergenic
1192097084 X:68223534-68223556 TTGGAGACTCAGAAAAAGGGTGG + Intronic
1192098515 X:68239071-68239093 ATGGGGAGCCAGAAGGAGGATGG + Intronic
1192284389 X:69719505-69719527 TTGGAGACTCAGAAGTGGGGAGG - Intronic
1192432246 X:71120237-71120259 ATCTAGATTAAGAAGGAGGATGG - Intronic
1192511427 X:71722654-71722676 AGGGAGACACAGAGGGAGTATGG - Intergenic
1192515270 X:71758851-71758873 AGGGAGACACAGAGGGAGTATGG + Intergenic
1192591563 X:72364235-72364257 AAGGAGACTGAGAAGGAACAGGG - Intronic
1192884445 X:75321994-75322016 TTGGAGACTGAGAAGGGGTAGGG - Intergenic
1192961375 X:76134863-76134885 CTGGAGACTCAGAAGCAGAGAGG + Intergenic
1193187515 X:78530448-78530470 TTAGAGACTCAGAAGGGGGAGGG - Intergenic
1193218303 X:78891576-78891598 ATGGAGACTTAGAATGATAAGGG + Intergenic
1193460316 X:81783798-81783820 TTAAAGACTCAGAAGGGGGAGGG - Intergenic
1193470943 X:81902571-81902593 TTGGAGACTCAGAAGGGGGAGGG - Intergenic
1193601538 X:83512572-83512594 ATGGAGAGGAAGAAGAAGGATGG - Intergenic
1193617174 X:83703485-83703507 TTGGAGACTCAGAAGTAGGAGGG - Intergenic
1193979184 X:88159897-88159919 ATGGAGACTCAGAATGATGGTGG - Intergenic
1194088515 X:89558244-89558266 TTAGAGACTCAGAAGGGGGAGGG + Intergenic
1194089909 X:89572931-89572953 TTAAAGACTCAGAAGGGGGAGGG - Intergenic
1194145648 X:90258690-90258712 TTGGAGATTCAGGAGGGGGAAGG + Intergenic
1194228439 X:91291606-91291628 TTGGAGACTCAGAAGTGGGTAGG - Intergenic
1194453931 X:94079529-94079551 TTGGAGACTCAGAAGCAGGGAGG - Intergenic
1194615312 X:96093651-96093673 TTGGAGACTCAGAAGGGAGGAGG + Intergenic
1194695109 X:97038013-97038035 CTGGAGACTCAGAAGGGGGTAGG - Intronic
1194903188 X:99540672-99540694 ATGGAGTCCCAGAAGGAGAAAGG + Intergenic
1195010283 X:100726931-100726953 ATGGAGACTCAGAAGGGTGAGGG - Intronic
1195144264 X:101997717-101997739 ATGGAGATTGAGGAGGAGTATGG + Intergenic
1196328974 X:114445541-114445563 ATGAAAACTCCGAAGGAAGATGG - Intergenic
1196557934 X:117112704-117112726 TTGGAGACTCAGAAGCAGGAGGG + Intergenic
1196796847 X:119508749-119508771 CTAGAGACTCAGAAAGGGGAGGG - Intergenic
1197048661 X:122031291-122031313 TTAGAGACCCAGAAGGAGGAGGG - Intergenic
1197053375 X:122088259-122088281 GTGGAGTCTCAGAAGGAAAAGGG - Intergenic
1197371661 X:125634289-125634311 TTGTAGACTTAGAAGCAGGAAGG + Intergenic
1197571314 X:128154156-128154178 TTGGAGACTCAGAAGTAGGAGGG + Intergenic
1197618410 X:128719967-128719989 ATGGAGACTCAGAAGGAGGATGG - Intergenic
1197645952 X:129016681-129016703 TTGGAGACTCAGAAGGGGGTAGG - Intergenic
1197821169 X:130542333-130542355 AGGGAGACACAGAAGGGAGATGG - Intergenic
1197987602 X:132283612-132283634 TTGGCGTCTCAGAAGGGGGAAGG - Intergenic
1198038327 X:132823431-132823453 TTAGAGACTCAGAAGGAGGAGGG - Intronic
1198134421 X:133733273-133733295 TTAGGGACTCAGAAGGGGGAGGG + Intronic
1198417189 X:136432612-136432634 CTGGAGACTCAGAAGGGGGAAGG - Intergenic
1198593215 X:138207750-138207772 ATGGACACTCATAAGAAGAAAGG + Intergenic
1198661753 X:138976533-138976555 ATAAAGACTCAGAAGGGGGATGG + Intronic
1198676451 X:139136354-139136376 TTAGAGACTCAGAACGGGGAGGG - Intronic
1198801548 X:140452773-140452795 TTGGAGATACAGAAGGAGCAGGG + Intergenic
1199078096 X:143546956-143546978 TTAGAGACTCAGAAGGGGGAAGG + Intergenic
1199110821 X:143931843-143931865 TTGGAGATTCAGAAGGGGAAGGG - Intergenic
1199242274 X:145561180-145561202 TTGGAGACTTAGAAGGGGAAGGG + Intergenic
1199387873 X:147243980-147244002 ATGGAGAAAAAGAAGAAGGAAGG - Intergenic
1200135740 X:153873771-153873793 ATGGAAACTCAGAGGCAGCAGGG - Intronic
1200353995 X:155528489-155528511 CTGGAGACTCAGAAGGGGAGAGG - Intronic
1200441191 Y:3214291-3214313 TTAGAGACTCAGAAGGGGGAGGG + Intergenic
1200442560 Y:3228985-3229007 TTAAAGACTCAGAAGGGGGAGGG - Intergenic
1200491400 Y:3827990-3828012 TTGGAGATTCAGAAGGGGGAAGG + Intergenic
1200794309 Y:7326496-7326518 CTGGAGACTCAGAAGTGGGGAGG + Intergenic
1200806212 Y:7436191-7436213 TTGGAGACTCCAAAGTAGGAAGG - Intergenic
1200910060 Y:8523971-8523993 ATGGGGAGCCAGAAGGAAGATGG - Intergenic
1200960203 Y:8989482-8989504 ATGGAGAGCCAGAAGGGAGATGG - Intergenic
1201066423 Y:10099957-10099979 ATGGAGACTCAGGAGGGTGAGGG - Intergenic
1201461533 Y:14230782-14230804 AGGGAGACAGAGAGGGAGGAAGG + Intergenic
1201504709 Y:14685422-14685444 ATTGAGAGTCAGAGAGAGGAAGG - Intronic
1201517700 Y:14835664-14835686 ATGGAGACAAAAAAGAAGGAAGG + Intronic
1201584368 Y:15544756-15544778 ATAGAGACTCTGCAGAAGGAGGG + Intergenic
1201695339 Y:16818278-16818300 ATGGGGACTTAGAAGGCGGATGG + Intergenic
1201761461 Y:17543930-17543952 ATGGAGACTCAGCAGGGTGAGGG + Intergenic
1201840091 Y:18362060-18362082 ATGGAGACTCAGCAGGGTGAGGG - Intergenic
1202111115 Y:21421701-21421723 ATGGGGACCCAGAAGGCAGATGG + Intergenic
1202267248 Y:23033222-23033244 AGGGATACTCTGAAGGATGAAGG + Intergenic
1202420240 Y:24666966-24666988 AGGGATACTCTGAAGGATGAAGG + Intergenic
1202450546 Y:25003116-25003138 AGGGATACTCTGAAGGATGAAGG - Intergenic