ID: 946859548

View in Genome Browser
Species Human (GRCh38)
Location 2:223987738-223987760
Sequence AGGGGCTTTCTGGAAAAACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 229}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946859548_946859555 13 Left 946859548 2:223987738-223987760 CCCAGTTTTTCCAGAAAGCCCCT 0: 1
1: 0
2: 3
3: 27
4: 229
Right 946859555 2:223987774-223987796 TTCCACTTTAAGTGCTACTAGGG 0: 1
1: 0
2: 0
3: 4
4: 116
946859548_946859557 27 Left 946859548 2:223987738-223987760 CCCAGTTTTTCCAGAAAGCCCCT 0: 1
1: 0
2: 3
3: 27
4: 229
Right 946859557 2:223987788-223987810 CTACTAGGGAAGACGTAACTAGG 0: 1
1: 0
2: 0
3: 2
4: 55
946859548_946859554 12 Left 946859548 2:223987738-223987760 CCCAGTTTTTCCAGAAAGCCCCT 0: 1
1: 0
2: 3
3: 27
4: 229
Right 946859554 2:223987773-223987795 TTTCCACTTTAAGTGCTACTAGG 0: 1
1: 0
2: 1
3: 11
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946859548 Original CRISPR AGGGGCTTTCTGGAAAAACT GGG (reversed) Intronic
901178941 1:7326630-7326652 AGGTGCTTGCTGGCAACACTTGG - Intronic
901586361 1:10297025-10297047 AGGGAGCTTCTGGAAAAACAAGG + Exonic
905651405 1:39659455-39659477 AAGGGCTTTCTGGAGGCACTGGG - Exonic
908477343 1:64502940-64502962 CTGGGGTTGCTGGAAAAACTTGG + Intronic
908929564 1:69302769-69302791 AGGGGCTATCTAGCAAAATTTGG + Intergenic
910972742 1:92872968-92872990 AGAGGCTTTGTGGAAAACCAGGG - Intronic
919774678 1:201186655-201186677 AGCAGCTTTCTGGAATGACTTGG + Intergenic
920082169 1:203382746-203382768 TGGGGCTTTCAGGAACCACTTGG - Intergenic
920309854 1:205042783-205042805 AGGGGATTTCTGGGGAAACCAGG + Intergenic
921228462 1:213044777-213044799 AGGGCCTCTCTGCAAAGACTGGG - Intergenic
923723489 1:236487030-236487052 AGGGGCTTTCTGGAGGCACTTGG - Intergenic
924183113 1:241459090-241459112 AAGGGCTTTCTGGAAAACCTGGG + Intergenic
924379536 1:243449649-243449671 AAGGGCCATGTGGAAAAACTGGG - Intronic
1063465927 10:6244404-6244426 ATGGTCTTTCTGGACCAACTTGG + Intergenic
1064097130 10:12432095-12432117 AAGGGCTGTCTGGAGACACTGGG + Intronic
1064434574 10:15300011-15300033 AGGGGCTTGCTGGAAAACTATGG + Intronic
1064492027 10:15868523-15868545 AGACGCATTCTGGAATAACTAGG - Intergenic
1064676160 10:17762480-17762502 AGAGGATTTCTAGTAAAACTAGG - Intronic
1066667827 10:37803433-37803455 ATGGGCTTTCAGGAAGAATTAGG - Intronic
1067560045 10:47298978-47299000 GGGAGCTTTCTGGAAGAACATGG + Intergenic
1067963630 10:50884783-50884805 AGGGGGTTTCTGGTAAAAATGGG + Intronic
1068451967 10:57202308-57202330 AGGTGTTTTGTGGTAAAACTTGG + Intergenic
1073110134 10:101057829-101057851 ACTGGCTTTCTGGAATACCTAGG - Intergenic
1074036552 10:109745036-109745058 AGGGGCATTCAGGCAAAACCTGG - Intergenic
1074354277 10:112768300-112768322 AGGCGCTTTCTGGAGAGGCTTGG + Intronic
1074988109 10:118675277-118675299 TGGGGCTGTCTGGAAAAAGCTGG - Intronic
1076430941 10:130401883-130401905 AGGGGCTTCCTGGGAACCCTGGG + Intergenic
1078140687 11:8690588-8690610 AGTGGCTTTCTGACAACACTGGG - Intronic
1078428356 11:11269031-11269053 AGGGGCATTCAGGAGCAACTGGG + Intergenic
1079032742 11:16997664-16997686 AGGGGCTCTCTGCAACACCTGGG + Intronic
1079682443 11:23315480-23315502 TGGAGCTTTCTGGACCAACTGGG + Intergenic
1080819304 11:35790012-35790034 AGCCGGCTTCTGGAAAAACTGGG + Intronic
1084709998 11:70838150-70838172 TGGGGCCTTCTGGAAGACCTGGG + Intronic
1086896047 11:92313863-92313885 AGTGGCTTACTGGAAAAATTAGG - Intergenic
1091036940 11:132243229-132243251 GGAGGCTTTCTGGAAGAGCTTGG + Intronic
1091516281 12:1185596-1185618 TGGGACTTTCTGGCAACACTTGG - Intronic
1091607764 12:1970744-1970766 AGTGGCTTTACGGGAAAACTTGG - Intronic
1095721402 12:45405264-45405286 AAGGGTTTTCTGAAAAAAGTAGG + Intronic
1096217665 12:49807289-49807311 AGGGGACTTCTGAAAACACTTGG + Intronic
1097601866 12:61703055-61703077 ATGGTCTTACTGGAACAACTTGG - Intergenic
1098282701 12:68877820-68877842 ATGGCCGTTCTGGAAAATCTGGG - Intronic
1098651693 12:72978587-72978609 ATGGGCTATCTGGAAAATTTAGG - Intergenic
1099329570 12:81266257-81266279 AGGGTCTTTCTGGAAGAAGTGGG - Intronic
1101602674 12:106224175-106224197 AGGGGCCATCAGGAAAAATTGGG + Intergenic
1102559218 12:113750081-113750103 AGGGGCCCTCTGGAAACATTTGG + Intergenic
1102742639 12:115221839-115221861 AGGGGCATTCTGCAAATACTTGG + Intergenic
1106515068 13:30445962-30445984 AGGAGATTACCGGAAAAACTGGG + Intergenic
1108026466 13:46183457-46183479 AGGGGCTATCTTGAGGAACTGGG + Intronic
1110494831 13:76155266-76155288 AGCAACTTTTTGGAAAAACTGGG + Intergenic
1113174593 13:107547948-107547970 AGGGGCTTTCTAGACAAGCATGG - Intronic
1113890852 13:113734893-113734915 AGGGGCCTTCTGGGAACACTGGG + Intronic
1115641271 14:35337066-35337088 AGGGGATTTCTGGAAGAACTGGG - Intergenic
1116161856 14:41277406-41277428 AATTGCTTTCTGGAAAAATTTGG - Intergenic
1116592137 14:46791290-46791312 AGAGGCTTTCTGTAAAAAGCAGG - Intergenic
1117096168 14:52300599-52300621 AGAAGCTTTGTGGCAAAACTGGG - Intergenic
1117156839 14:52950684-52950706 CGGGGCTTTCGGCAGAAACTCGG + Intronic
1118010192 14:61602883-61602905 AGGGCCTTTGTTGAAAATCTAGG + Intronic
1118963320 14:70556065-70556087 AGCTGCCTTCTGGAAAGACTTGG - Intergenic
1119117903 14:72044325-72044347 AGGGTGTTTCTGGAAGAAATTGG + Intronic
1120050475 14:79860382-79860404 GGGGGATTTCTGGAAAAGCATGG + Intronic
1121275212 14:92662756-92662778 TAGGGGTTTCTGGATAAACTGGG - Intronic
1121801495 14:96777924-96777946 AGGGGATTTCTGGAATTACAAGG - Intergenic
1122909167 14:104818478-104818500 AGGGCGTTTCTGGAAGAAGTTGG - Intergenic
1123960187 15:25390289-25390311 AGCGACTTTCTGTAAATACTAGG - Intronic
1124160967 15:27269435-27269457 AGGAACTTTCTGGGAAAACCTGG - Intronic
1125139794 15:36391857-36391879 AAGGGCTTTCTGAAAAAGCTTGG - Intergenic
1127792654 15:62412042-62412064 AGGGACTTTTGGGAAACACTGGG + Intronic
1129089470 15:73133606-73133628 AGGGTCAGTCTGGAAAAGCTTGG - Intronic
1129707235 15:77801727-77801749 AGGCCCCTTCTGGAAACACTAGG + Intronic
1130163748 15:81430061-81430083 AGTGGCTTTTTGGAAAGATTGGG - Intergenic
1130356413 15:83134888-83134910 AGGTGCTTTCTGGACATTCTAGG - Exonic
1131311321 15:91292919-91292941 AGGAGCTTTCTGGAGGAACCTGG - Exonic
1131582494 15:93658470-93658492 AGGAGCTTTATGGATAAACATGG + Intergenic
1135650085 16:24198350-24198372 AAGGGCTTACTGTGAAAACTGGG + Intronic
1137766952 16:50985136-50985158 AGGGGCTTTCAGGCAAAAGGGGG + Intergenic
1137988363 16:53129967-53129989 GGGGGCGTACTGGAAAACCTGGG - Intronic
1138938668 16:61762237-61762259 TGGGGCTATCTGAATAAACTGGG + Intronic
1139229604 16:65270981-65271003 ATGGGCTGTCTGGAAAAGGTGGG - Intergenic
1139331038 16:66190353-66190375 AGGTTCTTTGTGGAAAACCTAGG - Intergenic
1139965118 16:70741054-70741076 AGGGACTGTCTGGAAAGCCTCGG - Intronic
1143249703 17:5514209-5514231 AGGGGTTTTCTGGTAAAAACTGG + Intronic
1144408273 17:14973997-14974019 AGAGGCCATCTGGAAACACTGGG + Intergenic
1144823679 17:18093224-18093246 GGGGGCATTCTGGAAATTCTGGG - Intronic
1144945568 17:18967953-18967975 AGGGGCTTTCAGGAGAACCCCGG - Intronic
1145897015 17:28464965-28464987 AGTGGCTTTCTGGCAAAATGTGG - Intronic
1147395057 17:40136006-40136028 AGGAGATTTCTAGAAAAACTGGG + Intronic
1147766395 17:42839233-42839255 AGGAGCTGTCTGGAAACAATTGG + Intronic
1149028717 17:52060375-52060397 AGGACCTTAGTGGAAAAACTCGG + Intronic
1149422328 17:56522487-56522509 AGGGACTACCTGGGAAAACTGGG + Intergenic
1149661114 17:58334397-58334419 AGGGGGTTTCTGGATAGTCTAGG + Intergenic
1150582974 17:66492126-66492148 AGTGGCTGTCTGGAAACACATGG + Intronic
1154375415 18:13804994-13805016 AGGGCTTTACTGGAAAAAGTGGG + Intergenic
1155619742 18:27764541-27764563 TGGGGCTTTCTGGTAGAACCAGG - Intergenic
1156352340 18:36311937-36311959 AGGGACTTTCTGGACAAAAGAGG - Intronic
1157848820 18:51029234-51029256 AGGGGCTTTCTGGTCAAAGAGGG + Intronic
1158471563 18:57741765-57741787 GGGGGCTCTTTGGAATAACTTGG - Intronic
1159009294 18:63042997-63043019 AGGGGAATTCTGGAAAAAATGGG + Intergenic
1160017036 18:75152617-75152639 AGGGGATTCCTGCAACAACTGGG - Intergenic
1160044326 18:75372644-75372666 AGGGTCTCTCTGGCAGAACTTGG - Intergenic
1160207638 18:76848250-76848272 AGGGGCTTTCTTGAGCTACTTGG + Intronic
1162003365 19:7762249-7762271 GGGGGCTTTCTGGAAGGAGTGGG - Intergenic
1162997960 19:14348461-14348483 AGGGGCTTTTTGGTCAAACGAGG - Intergenic
1163096090 19:15058138-15058160 AATGGCTTTCTGGAAAAAGTAGG - Exonic
1164719281 19:30420372-30420394 AGGAGCTTTCCGGAAAGAATGGG - Intronic
1165122954 19:33574115-33574137 AGGTTCTTTCTGGAATAACTGGG + Intergenic
925316740 2:2932441-2932463 GGGGGATTTCTGGATAAACGTGG - Intergenic
925676674 2:6369226-6369248 AGGGTGTTTCTGGAAGAAATTGG + Intergenic
926633624 2:15158883-15158905 AGGGGGCCTCTGGAAACACTGGG - Intergenic
929083102 2:38140262-38140284 AGGGGCTCTCTGCCACAACTTGG - Intergenic
929968157 2:46550980-46551002 AGGAGCTTTTTGGAAGATCTAGG + Intronic
930625936 2:53697780-53697802 CAGGGCTTCCTGGATAAACTGGG + Intronic
931963988 2:67513209-67513231 AGGGGATTTCTGAAAAGAATGGG - Intergenic
932772563 2:74508583-74508605 AAAGGCTTTCTGGAGAAAGTGGG + Intergenic
933728829 2:85441916-85441938 GGGGGCTTTCTGGTAAAAACTGG + Intergenic
935926996 2:108080288-108080310 AGTGGCTTTCAGGAAAAATAAGG + Intergenic
936871605 2:117139715-117139737 AGGGCCTTTCTGACAAAACCCGG + Intergenic
939904015 2:147887974-147887996 CTGGGCTTTCTGGAACTACTGGG + Intronic
940268755 2:151868825-151868847 AGTGGCTTGCTGGTCAAACTAGG - Intronic
942094001 2:172520948-172520970 AGGGGCCATCTGGAAAAAAATGG - Intergenic
944388467 2:199191098-199191120 GGGAGCTTTCTGGCAAAAATTGG - Intergenic
945889506 2:215413508-215413530 AGGGACTTCATGGAAAAAGTAGG - Intronic
946488792 2:220127442-220127464 AGCAGCTTTCTGGTAAAAGTTGG - Intergenic
946859548 2:223987738-223987760 AGGGGCTTTCTGGAAAAACTGGG - Intronic
947388088 2:229612335-229612357 ATGGGCATTCTGGATACACTGGG + Intronic
948231749 2:236354128-236354150 AGGGGCTCACAGGAAAGACTGGG + Intronic
1171519676 20:25766213-25766235 AGGGGCTTCCTGGAAAGAGAGGG + Intronic
1171557244 20:26090280-26090302 AGGGGCTTCCTGGAAAGAGAGGG - Intergenic
1173132338 20:40406137-40406159 AGAGGCTGACTGGAAAAGCTTGG + Intergenic
1174401482 20:50278278-50278300 AGGGGATTTCTGGAAGACCAGGG - Intergenic
1174624767 20:51905008-51905030 AGGGGCTTTCCGGCAAAAACTGG - Intergenic
1181621236 22:24092776-24092798 AGGGGCATACTGGAATCACTAGG - Intronic
1181688250 22:24543710-24543732 AGGGGCTTTGGGGAAAAGGTAGG + Intronic
950358179 3:12429303-12429325 CAGGGCTTGCTGGAAACACTTGG - Intronic
950705173 3:14775027-14775049 AGGGGCTGCCTGCAAAGACTGGG - Intergenic
952421375 3:33134437-33134459 AGCGGCTTTCTAGGAAACCTAGG + Intronic
954075934 3:48180367-48180389 AAGGGCTTTCTGGCAAAAACCGG - Intronic
954168952 3:48784462-48784484 AGGAGATTTCTGGCAACACTGGG - Intronic
956489199 3:69753318-69753340 AGAGGATGTATGGAAAAACTTGG + Intronic
956865063 3:73361469-73361491 AGAGGATTTATGGAAAAACAAGG - Intergenic
959033801 3:101335968-101335990 AGGGCTTTTCTAGACAAACTGGG - Intronic
959643019 3:108663098-108663120 AGGGGTTATCAGGAAGAACTAGG + Intronic
960416095 3:117386838-117386860 AGGTGCTGAATGGAAAAACTGGG + Intergenic
962852411 3:139318006-139318028 AAGCGCTCTCTGGACAAACTAGG - Intronic
965950297 3:174300349-174300371 AGGGTCTCTATGGAACAACTGGG + Intergenic
967919849 3:194606292-194606314 GGGGGCTTGCTGGGAAAACAAGG + Intronic
969206844 4:5653589-5653611 AGGGGCATTTGGTAAAAACTAGG + Intronic
970411886 4:15816873-15816895 AGGGGCTTTGGCCAAAAACTAGG + Intronic
971111850 4:23593710-23593732 AGGGTGTTTCTGGAAAATATTGG - Intergenic
971268496 4:25115232-25115254 AGGAGCTTTCTGGGAGAACTTGG - Intergenic
971487037 4:27170984-27171006 AGAGGGTTTCTGGAAAAGATTGG - Intergenic
972123512 4:35735490-35735512 AGGAGCTTTCTGGAACAACTTGG - Intergenic
972127834 4:35791087-35791109 AAAGGCTTTCTTGAAAAAATTGG - Intergenic
973613247 4:52657330-52657352 GGGGGCTTTCTGGCACACCTGGG - Intronic
975191114 4:71463639-71463661 AGTGGTTTTCTGGAAGAAATTGG + Intronic
975485984 4:74934228-74934250 AGACGTTTTCTGGAAAAAATAGG - Intronic
976541801 4:86286037-86286059 AGGGTGTTTCTGGAAGAAATTGG - Intronic
979366367 4:119829098-119829120 ACGGGATTTCTGGCAAAACATGG - Intergenic
980145428 4:128977785-128977807 AAGGGCCTTCTGGATATACTAGG + Intronic
980548450 4:134301803-134301825 AGGGGCTTGGTGGTAAGACTAGG - Intergenic
981595799 4:146420388-146420410 AGAAGCTTTCATGAAAAACTTGG + Intronic
981833073 4:149024090-149024112 AGGTGCTTTCTGGAATACCCTGG + Intergenic
982019660 4:151190685-151190707 AGGGGATTTATGGAAACACCTGG + Intronic
982693867 4:158577871-158577893 ATGGGTTTTCTGAGAAAACTGGG - Intronic
989123536 5:38028641-38028663 ATGAGCTTTCTGGACAGACTTGG + Intergenic
989379427 5:40798437-40798459 AGGGGCTTCCTGGAACGATTAGG + Intergenic
989392026 5:40911067-40911089 AGGGGCTTTCCAGCAAAAATTGG + Intronic
990341416 5:54826765-54826787 AGAGGCATTTTGGAAAACCTAGG + Intergenic
990382265 5:55229531-55229553 AGGGGCTATGCAGAAAAACTTGG - Intergenic
991264694 5:64703707-64703729 AGGTGAATTCTGGAAAAAATAGG + Intronic
993638231 5:90371229-90371251 AGAGGATTTATGGAAACACTTGG - Intergenic
993716490 5:91280126-91280148 AGGGACTTACTGTAAAAACTGGG - Intergenic
995215665 5:109591714-109591736 CGGGGCTTTCAGCAAAGACTTGG + Intergenic
996986741 5:129576610-129576632 AGGGGCTATTTGGAAAAAATGGG - Intronic
998355343 5:141530642-141530664 AGGGTCTTCCTGGAACAAATGGG - Intronic
1001713811 5:173798496-173798518 AGGGGCCTTCTGGAAAAGAGAGG - Intergenic
1001892455 5:175350886-175350908 TGGGGCCTTCTGGAAATACCTGG - Intergenic
1003241083 6:4346470-4346492 AGAGGCTTTCTGGCCATACTTGG - Intergenic
1005363757 6:25056904-25056926 AGGGGTTTCCTGGAATGACTAGG - Intergenic
1008017291 6:46534948-46534970 AGGGGATATGTGGAAAATCTCGG - Intergenic
1008762063 6:54862979-54863001 AGGGTGATTCTGGAGAAACTGGG + Intronic
1009270795 6:61610917-61610939 AGGACCATTCTGGAAATACTTGG + Intergenic
1010753696 6:79642958-79642980 AGGGGCTTTGTGGAAAAATGTGG + Intronic
1011135363 6:84094180-84094202 GGGGGCTCTCTGAAAAAATTAGG - Intergenic
1013542637 6:111125873-111125895 AGGAGTTTTCTGGAAAACCTAGG + Intronic
1014452836 6:121601312-121601334 AGGGTCAATCTGGAGAAACTAGG + Intergenic
1016159004 6:140852619-140852641 AGGGTGTTTCTGGAAGGACTGGG - Intergenic
1017664410 6:156705608-156705630 AAGGGCTTTCTTGGAAAATTGGG - Intergenic
1018202585 6:161409467-161409489 AGGGGCACTCTGGAAAGACTGGG - Intronic
1018891754 6:167987764-167987786 AGCGGCTTCCTGGAACAACGGGG - Intergenic
1021019706 7:15581469-15581491 AGTTTCTTTCTGGGAAAACTGGG + Intergenic
1021676606 7:23086291-23086313 TGGGGCTTTTTGGAAATACTTGG + Intergenic
1022132237 7:27415302-27415324 AAGTGCTTCCTGGACAAACTGGG + Intergenic
1022227890 7:28382287-28382309 AGGGTGTTTCTGGAAAAGATGGG - Intronic
1022810292 7:33861572-33861594 AGGTGCTCACTGGAAGAACTGGG + Intergenic
1023296528 7:38720879-38720901 TGAGGCTATCTGGAATAACTGGG + Intergenic
1023514954 7:40992625-40992647 AGGGTTTTTCTGGGAAAAATGGG + Intergenic
1023659257 7:42456083-42456105 AGGAGCATTCTGGAAACAGTGGG + Intergenic
1024501345 7:50111272-50111294 AGAGGCTTCCTGGAGAAAATGGG + Intronic
1024696867 7:51866883-51866905 AGGGGCCTAGTGGAAAGACTGGG + Intergenic
1026474547 7:70723474-70723496 AGGGGCTTTCTGCCAAATCCAGG - Intronic
1026597068 7:71742228-71742250 AAGAGCTTTCTGGAAAGATTAGG - Intergenic
1027925115 7:84450379-84450401 AGGAACTTTCTGGAAAAACCTGG + Intronic
1029025246 7:97410201-97410223 ATGGATTTTCTGGAAAAATTGGG + Intergenic
1030863557 7:114669255-114669277 AGGGGATTTCAGCAAAAAGTAGG + Intronic
1032834887 7:135663204-135663226 ACGAGTTTTCTGGCAAAACTCGG + Intronic
1032849833 7:135784550-135784572 AGGTGCTTTATGGGAAAACAGGG + Intergenic
1033276227 7:139973485-139973507 ACAGACTTTCTGGAAAACCTAGG - Intronic
1033866859 7:145699686-145699708 AGGGGCTTCATGGAGAAACATGG - Intergenic
1035268489 7:157705697-157705719 AGGTGCCTTCTGGATAAACGCGG + Intronic
1035268646 7:157706545-157706567 AGGTGCCTTCTGGATAAACGTGG + Intronic
1035268682 7:157706741-157706763 AGGTGCCTTCTGGATAAACGTGG + Intronic
1035765856 8:2104877-2104899 CGTGTCTTTCTGGAAAGACTGGG - Intronic
1036451325 8:8870576-8870598 AGGGACTTTCTGTAAAACCAGGG - Intronic
1037775434 8:21832599-21832621 AGGGGCTTTTTGGGGAAAATGGG - Intergenic
1039155507 8:34552255-34552277 AGGGGCCTACCTGAAAAACTTGG - Intergenic
1039560047 8:38505360-38505382 AAAAGCATTCTGGAAAAACTGGG + Intergenic
1040723916 8:50358019-50358041 AGGGACTTTATGGATAAGCTGGG - Intronic
1042582725 8:70299304-70299326 AGGGGCTTTGTGAAAACTCTCGG - Intronic
1042885618 8:73546558-73546580 AGGGGATATATGGATAAACTAGG - Intronic
1043285852 8:78530013-78530035 AGTAGATTTCTGGAAAATCTAGG + Intronic
1043401112 8:79885148-79885170 AGGGGATTTCAGGAAAAATGAGG + Intergenic
1044563497 8:93637849-93637871 AGGGTGTTTCTGGAAAAAAAGGG - Intergenic
1044903892 8:96978816-96978838 TAGGGCTGTCTGGAAAACCTAGG + Intronic
1046343443 8:112889516-112889538 AGGTGCTGCCTGGAAATACTTGG - Intronic
1046396325 8:113645107-113645129 AGGAGATTTCTGGAAAGGCTGGG + Intergenic
1047308850 8:123675875-123675897 AGAGAGTTTCTGGAAACACTGGG - Intergenic
1050274200 9:3979823-3979845 ATGGTATTTCTGGAAGAACTAGG + Intronic
1050656869 9:7838188-7838210 AGTGGTTTTCTGGAAAAATTAGG + Intronic
1050738913 9:8797172-8797194 GGGGGCTTTCTGGCAAAAATTGG - Intronic
1052954955 9:34246689-34246711 AGGAGGTTTATGGAAAGACTTGG + Intronic
1055169012 9:73231925-73231947 TGGGGCTCTCTGGCAACACTGGG + Intergenic
1055614002 9:78052667-78052689 AGGAGCTTTCTGGGAAAAGAGGG - Intergenic
1056507570 9:87271526-87271548 AGGGGCTTCCTGCCCAAACTGGG - Intergenic
1057281009 9:93711519-93711541 AGGGCCTTTCTGGATGAAATCGG + Intergenic
1058663617 9:107288941-107288963 AGGGGTTTTCAGGGTAAACTTGG + Intronic
1060014111 9:120071543-120071565 AGGGACATTCCGGGAAAACTTGG - Intergenic
1186372332 X:8959925-8959947 AGGTGATTAGTGGAAAAACTTGG + Intergenic
1187787070 X:22903765-22903787 AGGGGCATTCTTGAAAAGCTCGG - Intergenic
1187934455 X:24322126-24322148 AGGGGCTATCTGGACATCCTAGG + Intergenic
1189141218 X:38608254-38608276 GGGGGCTTTCTGGTAAAAACCGG - Intronic
1189596952 X:42578020-42578042 AGGGCCTTTCTGCAAAGACTGGG - Intergenic
1189741359 X:44120217-44120239 AGGGCCTTTTTGGAGAACCTGGG - Intergenic
1194221891 X:91204544-91204566 AGGGGCTTTCCCTAAAAATTTGG + Intergenic
1194321129 X:92447571-92447593 AGGGGATTTGTGGAAACACCTGG + Intronic
1194475980 X:94360477-94360499 AGGGGTTTTCATGGAAAACTAGG + Intergenic
1194805011 X:98316467-98316489 AGTGGCTGTCTGGAAAAATTTGG + Intergenic
1197051981 X:122070547-122070569 AGTTGTTTTGTGGAAAAACTTGG + Intergenic
1198717317 X:139572157-139572179 AGGGGTTTTATGGGAAAACATGG - Intergenic
1199499279 X:148492194-148492216 AGAGGCTTTCTATACAAACTGGG - Intergenic
1200316607 X:155139270-155139292 ATGTTCTTTCTGAAAAAACTAGG + Intronic
1200558413 Y:4668309-4668331 AGGGGCTTTCCCTAAAAATTTGG + Intergenic
1200629247 Y:5560718-5560740 AGGGGATTTGTGGAAACACCTGG + Intronic
1200916509 Y:8575993-8576015 AGTGGCTCTCTGGGAAAGCTGGG - Intergenic
1200930433 Y:8691981-8692003 AGGGGCTTTCTGGGAAAAACAGG + Intergenic
1200931872 Y:8704060-8704082 AGAGGCTTTCTGGGAAATGTAGG + Intergenic
1200932419 Y:8709022-8709044 AGAGGCTTTCTGGGAAAAGTAGG + Intergenic
1200962511 Y:9008404-9008426 AGGGGCTCTCTGGAAAAGTCAGG - Intergenic
1201038582 Y:9807042-9807064 AGGGGCTCTCTGGGAAACGTAGG - Intergenic
1202068248 Y:20962656-20962678 AGGGGCTTCCTGGAGACACTGGG + Intergenic
1202150562 Y:21840117-21840139 AGGGGCTGTCTGGAAAAGTCAGG + Intergenic