ID: 946860728

View in Genome Browser
Species Human (GRCh38)
Location 2:223998098-223998120
Sequence ATACTGCGGCCACTCACCCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 77}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946860726_946860728 25 Left 946860726 2:223998050-223998072 CCTGGAGTCTAACTCATGCTTCA 0: 1
1: 0
2: 0
3: 8
4: 143
Right 946860728 2:223998098-223998120 ATACTGCGGCCACTCACCCCTGG 0: 1
1: 0
2: 0
3: 7
4: 77
946860725_946860728 26 Left 946860725 2:223998049-223998071 CCCTGGAGTCTAACTCATGCTTC 0: 1
1: 0
2: 0
3: 5
4: 140
Right 946860728 2:223998098-223998120 ATACTGCGGCCACTCACCCCTGG 0: 1
1: 0
2: 0
3: 7
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946860728 Original CRISPR ATACTGCGGCCACTCACCCC TGG Exonic
900089390 1:913239-913261 ACACTGCCTCCAGTCACCCCTGG - Intergenic
901081567 1:6586812-6586834 ATCCTGGGGCCACCCAACCCTGG - Intronic
901597783 1:10399016-10399038 AAACTGCGGCCGCTCACGCCCGG - Intronic
902173469 1:14631537-14631559 ATCCTGCTACCTCTCACCCCAGG + Intronic
904375923 1:30082506-30082528 GCACTGGGGTCACTCACCCCTGG + Intergenic
912540454 1:110411011-110411033 ATACTGTGGCCACTAGCCACAGG - Intergenic
917938028 1:179888343-179888365 ATACTGCAGCCACAAACTCCTGG + Intronic
1067069072 10:43119448-43119470 ACCCTGCGGCCTCCCACCCCTGG + Intronic
1077206478 11:1346944-1346966 ATGCTGCTGCCACCCACCCTAGG - Intergenic
1078062212 11:8055595-8055617 AGACAGAGGCCCCTCACCCCAGG + Intronic
1081795557 11:45816958-45816980 ATACTTCCCCCACCCACCCCTGG + Intergenic
1091263691 11:134253853-134253875 CTACTCCGGCCGGTCACCCCCGG + Intronic
1091929230 12:4381533-4381555 ATACTTCTTCCACTCAACCCTGG - Intergenic
1104844774 12:131841276-131841298 ATGCTGTGGGCACTGACCCCTGG - Intronic
1119374176 14:74175620-74175642 TTACTGCGGCCTCACACTCCTGG - Intronic
1123030031 14:105447243-105447265 ACACTGCGGCCGCTCAGCCTGGG - Intronic
1128145788 15:65331863-65331885 CTACTCAGGCCACTCACTCCAGG + Intronic
1131918926 15:97301855-97301877 GTACTGCAGCCACTCATCCCTGG + Intergenic
1131919127 15:97303550-97303572 GTACTGCAGCCACTCATCCCTGG - Intergenic
1137033524 16:35547151-35547173 CCACTGCGCCCACCCACCCCTGG - Intergenic
1142109113 16:88321924-88321946 ATCCTGTGGCCACTGAGCCCTGG - Intergenic
1143090758 17:4448073-4448095 ATACTGTGGCCAGTTGCCCCCGG + Intronic
1143781848 17:9233261-9233283 GTGCTGCGGCCACTCCCCCAGGG + Intronic
1147976902 17:44253066-44253088 ATCCTCCTGCCCCTCACCCCCGG - Intronic
1150294386 17:64000090-64000112 CTACTGCCACCCCTCACCCCTGG + Intronic
1152899193 17:82930238-82930260 AGGCTGCGGCCACTCACCTTGGG - Intronic
1154107448 18:11534585-11534607 ATAATGCTGCTACTCACACCTGG - Intergenic
1154170194 18:12046021-12046043 ATAATGCTGTCACTCACACCTGG + Intergenic
1154485463 18:14868366-14868388 ACAATGCTGCCACTCACACCTGG - Intergenic
1157338109 18:46756266-46756288 ACCCCACGGCCACTCACCCCGGG + Intronic
1163607114 19:18281510-18281532 AGGCCGCGGCCACTCCCCCCCGG - Exonic
927436112 2:23068003-23068025 AGAATGCAGCCACTCACCCTAGG + Intergenic
930804224 2:55473972-55473994 ACCCTCCGGCCACTCTCCCCCGG - Intergenic
931668887 2:64629145-64629167 AGACTGGGGACACACACCCCTGG - Intergenic
943809655 2:192168926-192168948 ATACTGCTGCCTCTAACTCCTGG + Intronic
946860728 2:223998098-223998120 ATACTGCGGCCACTCACCCCTGG + Exonic
949003149 2:241628863-241628885 TTACTGCGGCCACGACCCCCTGG - Intronic
1169026335 20:2374753-2374775 ATACTGCTCCCTCTCACCCTTGG - Intergenic
1169896593 20:10510927-10510949 ATGCTGCGTCCATTCACCCTGGG - Intronic
1173875606 20:46368782-46368804 ACACTGCAGCCACCCACCACAGG + Intronic
1175274492 20:57758817-57758839 ATACTGCAGCCACTGGCCACAGG + Intergenic
1176795873 21:13371111-13371133 ACAATGCTGCCACTCACACCTGG + Intergenic
1178471727 21:32899492-32899514 TTATAGCTGCCACTCACCCCTGG - Intergenic
1180289554 22:10784342-10784364 ACAATGCTGCCACTCACACCTGG + Intergenic
1182697720 22:32207649-32207671 ACAATGCTGCCACTCACGCCTGG - Intergenic
1182812639 22:33130623-33130645 ATAATGAGGCCACTAGCCCCAGG + Intergenic
1185250855 22:49800949-49800971 ACACTGTGGGCCCTCACCCCAGG - Intronic
1185333671 22:50262282-50262304 CTCCTGTGGCCACTGACCCCGGG + Intergenic
950664517 3:14487158-14487180 ATACTGTGGCCTTTCACCCAGGG - Exonic
963888002 3:150602593-150602615 TTACTGCAGCCTCACACCCCTGG - Intronic
978257316 4:106708381-106708403 TCACTGTGGCCACTCTCCCCTGG + Intergenic
981321170 4:143393653-143393675 ATAATGCGGACACTCACCACTGG - Intronic
983940819 4:173532508-173532530 AAAGTGAGGCCACTCACCGCTGG - Intergenic
985585936 5:734213-734235 ATACTGTGGCCTTTCACTCCAGG + Intronic
985600353 5:825625-825647 ATACTGTGGCCTTTCACTCCAGG + Intronic
986670511 5:10139307-10139329 AGACTGCCCCCACTCCCCCCAGG + Intergenic
986939976 5:12937622-12937644 ATACTGCAGGCCCTCCCCCCAGG - Intergenic
988112502 5:26840673-26840695 ATAATGCGGCTACTGATCCCTGG + Intergenic
995513319 5:112929424-112929446 ATACGGCGTTCACTCACCCTGGG + Intergenic
998027311 5:138829542-138829564 ATTCTTGGGCCAATCACCCCTGG + Intronic
1001980414 5:176034239-176034261 ACAATGCTGCCACTCACTCCTGG + Intronic
1002237047 5:177809826-177809848 ACAATGCTGCCACTCACTCCTGG - Intergenic
1002724244 5:181283801-181283823 ACAATGCTGCCACTCACACCTGG - Intergenic
1003825172 6:9944473-9944495 ACGCTGCTGCCACTCACCTCTGG - Intronic
1007868803 6:45008427-45008449 ATACTGCAGCCTCTAACTCCTGG + Intronic
1019158484 6:170054223-170054245 ATTCTGTGCCAACTCACCCCTGG - Intergenic
1021551448 7:21875461-21875483 AAACTGTGGACACTCTCCCCAGG + Intronic
1029063485 7:97824210-97824232 ATACATTGCCCACTCACCCCGGG + Intergenic
1029558410 7:101286420-101286442 CTACTGCTGACACGCACCCCGGG + Intergenic
1032084455 7:128876772-128876794 ATTCTGCGGCCACTGATCACTGG + Intronic
1034334786 7:150314154-150314176 ACACTGCTGCCACTGACCCTAGG - Intronic
1036756914 8:11477052-11477074 AAGCTGGGGCCACCCACCCCTGG + Intergenic
1041004660 8:53486656-53486678 ATACTGCAGCCCCTCCCCCCAGG - Intergenic
1042294742 8:67206686-67206708 ATGCTGCTGCCACGCAGCCCAGG + Intronic
1044832286 8:96261960-96261982 CTACTGTGGCTAGTCACCCCCGG + Exonic
1045318344 8:101062542-101062564 ATGCTGCGGCCACTGGCCGCAGG + Intergenic
1052460204 9:28753180-28753202 CTTCTGCGGTCACTCACTCCTGG - Intergenic
1053886382 9:42647235-42647257 ACAGTGCTGCCACTCACACCTGG - Intergenic
1054225402 9:62454684-62454706 ACAGTGCTGCCACTCACACCTGG - Intergenic
1055859530 9:80731132-80731154 ATACTGTGGTCACTCAGCCCTGG + Intergenic
1056652701 9:88481658-88481680 ACAATGCTGCCACTCAACCCTGG - Intergenic
1062440888 9:136568781-136568803 TCCCTGCGGCCCCTCACCCCGGG + Intergenic
1185464012 X:344781-344803 CTACTGCGGCCACGCGACCCAGG + Intronic
1188090062 X:25953160-25953182 GTGCTGTGGCCACTCACCCCTGG + Intergenic
1193458666 X:81762408-81762430 AAACTGCTGTCACTCAACCCAGG - Intergenic