ID: 946864035

View in Genome Browser
Species Human (GRCh38)
Location 2:224026763-224026785
Sequence GAATACACAAGCCTGTGTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 104}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946864035 Original CRISPR GAATACACAAGCCTGTGTTA AGG (reversed) Intronic
902055472 1:13597032-13597054 ATATACAAAAGCCTGTGTTTGGG + Intronic
902853195 1:19178005-19178027 GCATTAACACGCCTGTGTTAAGG - Intronic
906073803 1:43036614-43036636 GAATCCACCAGCCTGTGCTCTGG + Intergenic
909772913 1:79446916-79446938 GAATACACAGGCCTGTTTAATGG - Intergenic
914668067 1:149848912-149848934 GACAACACAAGCCTGTCTTTAGG - Intronic
915863929 1:159477845-159477867 GACTAAACAAGACTGTGGTACGG + Intergenic
921700386 1:218262659-218262681 GAATACACAAGTTTGTCTTTTGG + Intergenic
923221652 1:231900079-231900101 GAATAGTCTAGCCTGTGTTTGGG + Intronic
1067124940 10:43507939-43507961 CAATAAAAAAGCCTGTGTCATGG + Intergenic
1067534319 10:47097588-47097610 GAATACAGAAGCCAGCCTTAAGG + Intergenic
1068469948 10:57448291-57448313 GCATACTCAAGCCTCAGTTATGG + Intergenic
1073598816 10:104826064-104826086 GAATAGAGAACCCTGTGTTTGGG + Intronic
1076552285 10:131289171-131289193 GAAAAGAAACGCCTGTGTTAAGG - Intronic
1077701012 11:4442665-4442687 GAAGATACCAGGCTGTGTTAGGG - Intergenic
1079142861 11:17824390-17824412 GAAGACAAAGGCCTATGTTAAGG + Intronic
1083630367 11:64092070-64092092 GAATACACCAGAGTGTGCTATGG - Intronic
1085135602 11:74084749-74084771 GAGTTCAGAAGCATGTGTTAAGG + Intronic
1092777488 12:11956684-11956706 GAATACACAAGTCAGGCTTACGG + Intergenic
1096268708 12:50146082-50146104 GATTAAAGAAGCCTGGGTTAGGG - Intronic
1100073068 12:90745301-90745323 GAATACTCAAACCAGTGATAGGG - Intergenic
1101088027 12:101256069-101256091 GAAGACACAAGCTTGTGTGAAGG + Intergenic
1101562455 12:105870544-105870566 GTGTACACAGCCCTGTGTTATGG - Intergenic
1101958598 12:109231550-109231572 GAATGCACACACCTGTGTCAGGG + Intronic
1111367934 13:87274569-87274591 GAATTCCCAAGCCTGTGCTTAGG + Intergenic
1112804681 13:103151047-103151069 GAATACGCAAGAATATGTTACGG - Intergenic
1113537711 13:111081546-111081568 GGACACACATGCATGTGTTATGG - Intergenic
1113675365 13:112203067-112203089 GGATACACAGGCATGTGTTAGGG - Intergenic
1121380108 14:93457783-93457805 GATTACACAAGCTTGAATTAAGG + Intronic
1121892087 14:97603897-97603919 GAATACCCCAGCCTGGGCTAAGG - Intergenic
1129918437 15:79295621-79295643 CAATACAAGAGCCTGTGTCAGGG - Exonic
1134638073 16:15807896-15807918 GAATCCACCAGCTTGTGTTTGGG - Intronic
1135433477 16:22407810-22407832 GATTACACAAAACTGTGATAAGG + Intronic
1136019392 16:27430353-27430375 GAAGACACAAGCCTGTGGGCTGG - Intronic
1139242593 16:65409266-65409288 GAATACAGAAACACGTGTTAAGG - Intergenic
1157083931 18:44557848-44557870 AAATACACAAGCTTGGGTTTTGG - Intergenic
925146242 2:1585070-1585092 GAATACAGAAGCCTCTATTCCGG - Intergenic
925198396 2:1946447-1946469 GAAGACACAAGCATGGGGTAGGG + Intronic
926685460 2:15694487-15694509 GAGTCCTCAGGCCTGTGTTAGGG - Intronic
926785640 2:16515923-16515945 GAATCCACAAGGCTGTTTTCAGG - Intergenic
928025793 2:27737496-27737518 GAATACACAAGAGTGTGAAAAGG - Intergenic
929890018 2:45911099-45911121 GAATGCTCAAGCCTTTGCTAGGG - Intronic
932834394 2:75021973-75021995 GATTACACAACACTGTGCTAGGG + Intergenic
932972928 2:76567662-76567684 GAGTACACCTGCCTTTGTTAAGG + Intergenic
937011856 2:118570007-118570029 AAATCCACAAGCCTGTGCTGTGG + Intergenic
937052267 2:118902127-118902149 GAAAAGAACAGCCTGTGTTATGG + Intergenic
937395807 2:121533588-121533610 GAATACACAATTCTGTTTTATGG + Intronic
941385544 2:164846229-164846251 GAATAGACATTTCTGTGTTAAGG - Intergenic
941452520 2:165676944-165676966 AAATACACACTCCAGTGTTAGGG - Intronic
942140008 2:172968213-172968235 AAAAACACAAGCCTGTGTGGTGG - Intronic
942890718 2:180983418-180983440 AAATACATAGGCCTGAGTTAAGG - Intronic
943206870 2:184910431-184910453 AAAGACACATGCATGTGTTATGG - Intronic
943573056 2:189597081-189597103 AAATAAACAAGACTTTGTTAGGG + Intergenic
944453235 2:199865702-199865724 AAATACACAATCCCATGTTAAGG + Intergenic
946219056 2:218210874-218210896 AAATACACAAGCCTGATTTTTGG + Intergenic
946864035 2:224026763-224026785 GAATACACAAGCCTGTGTTAAGG - Intronic
1170751544 20:19152347-19152369 GAATACCCAACACGGTGTTAAGG + Intergenic
1174689906 20:52493516-52493538 GGATACATAAGCCTCTGTTTCGG - Intergenic
1183563243 22:38593661-38593683 GAAGACCCAAGCCTGTGTGAAGG - Intronic
1184338432 22:43870149-43870171 GAATAGACAAGTGTTTGTTATGG + Intergenic
951096080 3:18632935-18632957 GAATTCACATCCCTGTGCTAAGG - Intergenic
951245823 3:20340568-20340590 GAAGACACAAGCCTTTTTTTTGG + Intergenic
952062350 3:29525715-29525737 GTTCACACAAGCCTGTGTTTAGG - Intronic
954032206 3:47827640-47827662 GAATACACGTGCCTGGTTTAGGG + Intronic
954625369 3:52019497-52019519 GAACAGAGAAGCCTGTGATAAGG - Intergenic
959617274 3:108362364-108362386 AAATCCATAAGCCTTTGTTATGG - Exonic
959721689 3:109498008-109498030 GAATACAGAAGCCTGAGGAAAGG + Intergenic
959918631 3:111846670-111846692 AAATAGAAAAACCTGTGTTAGGG + Intronic
960351847 3:116603409-116603431 GAATACAGAATCCTGGGTTCTGG - Intronic
961112969 3:124300822-124300844 GAAGACACAAGACTGTGTTGTGG - Intronic
961732252 3:128974489-128974511 GAACACAGCATCCTGTGTTATGG - Intronic
963167392 3:142219513-142219535 AAAAAGACAAGACTGTGTTACGG + Intronic
971515043 4:27475022-27475044 GCACCCAAAAGCCTGTGTTATGG + Intergenic
973634290 4:52847684-52847706 GAATTCTCAAGCCTGTGCTATGG - Intergenic
976931314 4:90570117-90570139 GAATACAGAGGACTGTGTCATGG + Intronic
980513517 4:133824071-133824093 GAATGCCCAAGACAGTGTTATGG + Intergenic
981106097 4:140883321-140883343 AAATACACAATACTGTGATAGGG - Intronic
982306961 4:153942875-153942897 GAATACACAATTTTGTGTTTTGG + Intergenic
984385686 4:179054280-179054302 GAAAACACAAGCAAGTATTAGGG - Intergenic
986393901 5:7309534-7309556 CATTTCACAACCCTGTGTTATGG + Intergenic
986404701 5:7413745-7413767 GATTACACAAGCCTGGGCTTAGG - Intronic
986741423 5:10709084-10709106 GAATAGACAAGCATGTGCCATGG + Intronic
990211926 5:53490179-53490201 GAATACCCATGCCACTGTTAGGG + Intergenic
990212108 5:53491862-53491884 GAATACCCATGCCTCTGGTAGGG + Intergenic
990508695 5:56470412-56470434 CAATACAGAGACCTGTGTTAGGG + Intronic
991051709 5:62279729-62279751 GAATAGACAAGACAGTGTGATGG - Intergenic
993039795 5:82801110-82801132 GAATACACAGGATTGTTTTAGGG + Intergenic
994160244 5:96549207-96549229 GAATACACAAGTCAATGGTATGG + Intronic
997682445 5:135765882-135765904 GCATACACCCTCCTGTGTTATGG + Intergenic
1000650645 5:163814379-163814401 GAATACAGAAGCAAGTGTTACGG + Intergenic
1002018601 5:176346946-176346968 GAATAAAGAAGCCTGGGTTTTGG + Exonic
1004890870 6:20099160-20099182 GAAAACACAAGCCTTTATTTCGG + Intergenic
1007303956 6:40890208-40890230 CAATTCACAAGGCTATGTTAAGG + Intergenic
1008165771 6:48136526-48136548 CAAAACACAAGTCTGTGGTATGG - Intergenic
1009226987 6:61029205-61029227 GCATACACCCGCCTGTGATATGG - Intergenic
1009366788 6:62862665-62862687 GTATACACTACCCTGTGATACGG - Intergenic
1009682454 6:66915093-66915115 AAATACACAAGGGTGTTTTATGG - Intergenic
1012008233 6:93744220-93744242 GAATACACCTACCTGTATTATGG - Intergenic
1013466050 6:110417911-110417933 AAAAACACAAGACTGTGTTTAGG - Intergenic
1019985792 7:4654678-4654700 GAAAACAAAAGCCTGTGTGGAGG - Intergenic
1019985805 7:4654817-4654839 GAAAACAAAAGCCTGTGTTGAGG + Intergenic
1023472870 7:40543934-40543956 GAAAACAGAAGCCTGTTTTCAGG + Intronic
1030744588 7:113149596-113149618 GAAAACACAAGCCACAGTTATGG - Intergenic
1033283626 7:140022792-140022814 GACTGCACTTGCCTGTGTTAAGG + Intergenic
1034063882 7:148118421-148118443 GGACACACAAGCCTGAGTTTGGG + Intronic
1042290484 8:67165929-67165951 GAAGACACAAGTCTTTCTTATGG - Intronic
1045279031 8:100732993-100733015 GAATACAGAAGCCAGTTTAATGG + Intergenic
1045718021 8:105071131-105071153 GAATATAAAAGCCTGGGTTTAGG + Intronic
1053240232 9:36488605-36488627 AAATAAACAACCATGTGTTAGGG + Intergenic
1060899327 9:127243817-127243839 GAATCCCCAGGCCTTTGTTATGG + Intronic
1187694555 X:21905491-21905513 CAATACACAGGCCTGTGTGCAGG - Intergenic
1188895631 X:35665059-35665081 GAGTTCAGAAGCCTGTGTAAAGG + Intergenic
1192582638 X:72297913-72297935 GAAAACCCAAGCCTCTGTCAAGG - Intronic
1193492865 X:82170760-82170782 GAATACACAACCCAGAGATAAGG + Intergenic
1200466108 Y:3522259-3522281 AAATACACAACTCTGTCTTATGG - Intergenic