ID: 946864253

View in Genome Browser
Species Human (GRCh38)
Location 2:224028497-224028519
Sequence ATGATTGAGGCTAAGCCATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 110}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946864253_946864255 -2 Left 946864253 2:224028497-224028519 CCACATGGCTTAGCCTCAATCAT 0: 1
1: 0
2: 0
3: 15
4: 110
Right 946864255 2:224028518-224028540 ATTCCTGAAGATAGCGTTTCAGG 0: 1
1: 0
2: 0
3: 12
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946864253 Original CRISPR ATGATTGAGGCTAAGCCATG TGG (reversed) Intronic
900034877 1:399061-399083 ACGATCCAGGCTAAGCCAGGAGG - Intergenic
900055707 1:628939-628961 ACGATCCAGGCTAAGCCAGGAGG - Intergenic
901120017 1:6883559-6883581 AGGATTGAGGATAGACCATGTGG + Intronic
902886636 1:19409547-19409569 TTGATGGAGGCAATGCCATGTGG + Intronic
902994860 1:20216449-20216471 AGGAGTTAGGCAAAGCCATGTGG + Intergenic
904498958 1:30903115-30903137 GTGATTGAGGCTTAGAGATGGGG - Intronic
909972407 1:82006620-82006642 ATGATGGAGGCTCGGCCAGGTGG + Intergenic
912468611 1:109891298-109891320 GTGATTGCGGCTAAGCCCTATGG - Intergenic
915274356 1:154777686-154777708 ATGACTGAGACTAAGCCCTAGGG - Intronic
919078342 1:192839339-192839361 ATGCTTGAGGTTAAGATATGGGG + Intergenic
920366824 1:205452320-205452342 CTGGTTGAGGCTAAGCCAGGAGG + Intronic
924400630 1:243676727-243676749 ATGTTGGTGGCTTAGCCATGAGG - Intronic
1063998011 10:11639655-11639677 ATGAAAGAGGATAAGACATGGGG - Intergenic
1064385592 10:14888249-14888271 AGGATTGAGGATGAGCCCTGAGG + Intronic
1068569976 10:58617705-58617727 TTTATTGAGGCTTAGCCTTGTGG + Intronic
1068706388 10:60080769-60080791 ATGATTTTGGTTAAGACATGGGG - Intronic
1069566449 10:69466411-69466433 ATGATTGTAGCTGGGCCATGGGG + Intronic
1069802294 10:71089533-71089555 TTGATTAAGGCTAAGCAAGGAGG + Intergenic
1071102447 10:82054760-82054782 AAGAATGAGGCTGAGCCAGGAGG + Intronic
1071237099 10:83661768-83661790 AGGCTTCAGGCTAAGCCATGTGG - Intergenic
1071515547 10:86294474-86294496 ACGATGGTGGCTTAGCCATGGGG + Intronic
1072205090 10:93196609-93196631 ATGACTGAGACAAGGCCATGTGG - Intergenic
1073277944 10:102329245-102329267 ATGATTGAGGCCAGTCCCTGTGG + Intronic
1075772375 10:124950550-124950572 ATGTTTGAGGCAAATCCATTTGG + Intronic
1075797555 10:125131473-125131495 ATGAGTGAAGTGAAGCCATGAGG + Intronic
1085912170 11:80840491-80840513 GTGATTGATTTTAAGCCATGTGG + Intergenic
1086773491 11:90798934-90798956 GTGATTGAAGCTAAACCATGTGG + Intergenic
1090715277 11:129424830-129424852 ATGATTGAGCACAAGCTATGAGG + Intronic
1093059637 12:14589336-14589358 AGGGTTGAGGCTGAGCCCTGGGG - Intergenic
1095344626 12:41135372-41135394 AAGATTGAGGCTATGCCAGTAGG - Intergenic
1100371765 12:93975217-93975239 ATGCATGAGGCTAACGCATGAGG - Intergenic
1100760681 12:97803608-97803630 ATGTTGGTGGCTATGCCATGGGG + Intergenic
1101554572 12:105796660-105796682 ATGAATGATGGTAAGCCATCAGG + Intergenic
1103567857 12:121825931-121825953 ATGAATGAGGCCATGCGATGTGG - Intronic
1114604796 14:23988159-23988181 AGGATGGAGGCTAAGACCTGGGG + Intronic
1114610246 14:24035725-24035747 AGGATGGAGGCTAAGACCTGGGG + Intergenic
1116960097 14:50960280-50960302 ATGATTGAGACTAAGTGATTTGG - Intergenic
1121813793 14:96913823-96913845 ATGATGGTGACTAGGCCATGAGG + Intronic
1121969034 14:98339527-98339549 ATGATTCAGGATTAGCCAAGTGG + Intergenic
1126038283 15:44567423-44567445 TTGATTGAGTCTCAGCCCTGGGG - Exonic
1126182540 15:45799793-45799815 ATGATTGATGCTAGGCTCTGGGG + Intergenic
1129662116 15:77558813-77558835 ATGATTGAGGCAATGACAAGAGG - Intergenic
1129714514 15:77839480-77839502 ATGACTGAGGCCAACCCATCTGG + Intergenic
1130607221 15:85328909-85328931 ATAAGTGAAGCTAAGTCATGTGG - Intergenic
1133323661 16:4930520-4930542 ATGAATGAGAGTAAGCCATGGGG - Intronic
1133480972 16:6170161-6170183 ATGTGTGAGGCTATGGCATGAGG + Intronic
1141923319 16:87150962-87150984 ATGATAGTAGCTAAGACATGGGG - Intronic
1143443086 17:6990927-6990949 ATGATTGAGGCCAGGCACTGTGG + Intronic
1151000082 17:70365516-70365538 ATGTTTGAGGCAAAGCTTTGAGG - Intergenic
1157122823 18:44927573-44927595 AAGATTGAGGCTGAGCTATTTGG + Intronic
1157895867 18:51466433-51466455 CTCAGTGAGGCTAAGCCATCTGG + Intergenic
1161490316 19:4557705-4557727 ATGATTGAGGCTGGACCAGGTGG - Intronic
1167330021 19:48849671-48849693 AGGTCTGAGGCTAAGCAATGAGG + Intronic
929337125 2:40762539-40762561 AGGATTGTGGCTAGGCCAGGAGG + Intergenic
930093266 2:47547160-47547182 ATGAAGGAGGCTAAGCTAGGAGG - Intronic
931263017 2:60636913-60636935 AAGACTGAGACTGAGCCATGTGG - Intergenic
932195715 2:69781421-69781443 TTGCATGAAGCTAAGCCATGAGG - Intronic
946175681 2:217920814-217920836 ATGAGTGTGGCTAACACATGTGG + Intronic
946864253 2:224028497-224028519 ATGATTGAGGCTAAGCCATGTGG - Intronic
1170773040 20:19351006-19351028 ATAATGGAGGCTGGGCCATGGGG - Intronic
1171345895 20:24466061-24466083 ATGATTTGGGCTGAGCCATCTGG - Intergenic
1171996256 20:31733991-31734013 ATGAATGAGGCAATGCCAGGAGG - Intergenic
1172582832 20:36062087-36062109 ATCATTGAGGATTAGCCAAGTGG - Intergenic
1174712534 20:52722505-52722527 AGGATTGCAGCTAAGCCTTGTGG - Intergenic
1182039464 22:27225137-27225159 CTGATTGAGGGTAAGCCTTTTGG + Intergenic
1182928740 22:34152978-34153000 TTGATTGAGGCTGAGGCTTGGGG - Intergenic
949451619 3:4191534-4191556 ATAATTCAGGCTATGGCATGGGG + Intronic
951020395 3:17776294-17776316 AATATTGGGGCTAGGCCATGGGG - Intronic
954216845 3:49129397-49129419 GTGATTGAGGCTAAGACGTGTGG - Intronic
955047516 3:55374075-55374097 ATGGGTGAGGCTAAGCCAGGTGG - Intergenic
955064781 3:55525047-55525069 AGGACTGAGGATAAACCATGAGG - Intronic
962157464 3:132963425-132963447 AGGATTGAATCTAAGGCATGCGG - Intergenic
962851782 3:139313566-139313588 ACCACTGAGGCAAAGCCATGGGG + Intronic
964043758 3:152296857-152296879 ATCATTATGGCTAAGCCATGGGG + Intronic
972280303 4:37595841-37595863 ATGTTTGGGGCCAAGCAATGGGG + Intronic
976673776 4:87682383-87682405 ATTATTGAGGCCTAGACATGAGG + Intergenic
979238520 4:118427841-118427863 ATGATCCAGGCTAAGTCAGGAGG + Intergenic
979612631 4:122705212-122705234 CTGATTGAGGCTGAGCTATCTGG - Intergenic
981018396 4:139999819-139999841 AAGATTTAGGTTAAGCCATTTGG + Intronic
982005902 4:151062533-151062555 ATGAATGAGGCTGAGCACTGAGG - Intergenic
990477552 5:56175732-56175754 AAGCTTGAGGCTAAGGAATGTGG - Intronic
990616802 5:57516985-57517007 ATGATTGAGGCTAGGCGTGGTGG + Intergenic
992813185 5:80409319-80409341 ATGATTGAGGATAATTAATGCGG - Intronic
994651852 5:102539076-102539098 ATGAATTAGGCTAAGCCAATGGG - Intergenic
997235474 5:132269795-132269817 ATGTCTGAGGCCAGGCCATGGGG - Intronic
998673869 5:144385394-144385416 ATGCTTGGGGCCAAGCCATGGGG + Intronic
999912896 5:156224763-156224785 ATGCTTGAGACAAAGGCATGTGG - Intronic
1002162805 5:177326155-177326177 ATTATGGAGGCTGAGTCATGTGG + Intergenic
1002738942 5:181419810-181419832 ACGATCCAGGCTAAGCCAGGAGG + Intergenic
1002915107 6:1522701-1522723 AAGACTGAGGCTAAGCCCTGTGG - Intergenic
1003816859 6:9851319-9851341 GTGATGGAGGCTATGCCATGGGG - Intronic
1006197042 6:32250747-32250769 ATTATTGGGCCTAAGCCATAGGG + Intergenic
1007930942 6:45690024-45690046 ATGCTTGTGGCCAGGCCATGGGG + Intergenic
1009712985 6:67348327-67348349 TTTATTGAGGCTAAGCCTTGTGG + Intergenic
1013611095 6:111796036-111796058 GTGATAGAGTCTAAGCCATTGGG - Intronic
1014257578 6:119178341-119178363 ATGTTTCAGCCTAATCCATGGGG + Exonic
1015714897 6:136182554-136182576 ATGATTGAGTCAAAACCAAGTGG - Intronic
1019244050 6:170695362-170695384 ACGATCCAGGCTAAGCCAGGAGG + Intergenic
1021712047 7:23425615-23425637 ATTATTGAGGCCAAGGCAGGAGG - Intronic
1021980971 7:26055373-26055395 ATCATCAAGGCTAAGCCATGAGG + Intergenic
1023444107 7:40214409-40214431 ATAATTGAAGCTACCCCATGGGG - Intronic
1024088887 7:45919835-45919857 CTGATAGTGGCTAAGCCAAGAGG + Intronic
1026896839 7:74014209-74014231 ATGATTGAAGCTAGAACATGGGG + Intergenic
1029085468 7:98008211-98008233 ATGCTTGAGGCTAGGACATGGGG + Intergenic
1030211655 7:107002452-107002474 CTGATAGAGGCTGAGCCAGGAGG + Intergenic
1033463891 7:141573055-141573077 CTGAATGAGGAAAAGCCATGAGG - Intronic
1035504075 8:112798-112820 ACGATCCAGGCTAAGCCAGGAGG - Intergenic
1037593278 8:20331393-20331415 TTGAGTGAGGCTAAGGCAGGAGG + Intergenic
1037853203 8:22349801-22349823 ATGATTCAGGCTAACTCCTGGGG + Intronic
1039360395 8:36870497-36870519 ATCATTGAGGCTAAAAGATGGGG - Intronic
1047704437 8:127483681-127483703 TTGATTGTGGCTTAGCAATGAGG - Intergenic
1052014034 9:23444286-23444308 ATGACTGGGGCTAAGGCAGGAGG - Intergenic
1052041487 9:23744006-23744028 AAGATTAAGGCTAAGACAAGTGG + Intronic
1052320830 9:27165592-27165614 GTGATGTAGGCTAAGCCCTGAGG - Intronic
1055954526 9:81761540-81761562 GTGTTTGAGGATAAGTCATGTGG - Intergenic
1056898369 9:90573493-90573515 ATTATTAAGGATAAGACATGTGG + Intergenic
1059095362 9:111407626-111407648 ATAATTGAGGCTAAGGGCTGAGG - Intronic
1203604239 Un_KI270748v1:44586-44608 ACGATCCAGGCTAAGCCAGGAGG + Intergenic
1188711070 X:33398705-33398727 ATAATTGAGGCTAAGAAATTAGG - Intergenic
1189696544 X:43669971-43669993 AGGATTGAGACAAAACCATGAGG + Intronic
1191945379 X:66528913-66528935 ATGAGTGGAGCTAAGCTATGAGG + Intergenic
1196153075 X:112395782-112395804 ATCCTTGAGGCTCAGCCAAGAGG - Intergenic
1199030694 X:142995704-142995726 ATGATTGAGCCAAAACAATGAGG + Intergenic
1201325627 Y:12754529-12754551 ATAATTGAGGCTAAGCATGGTGG - Intronic
1202386291 Y:24329632-24329654 ATGATCCAGGCTAAGCCAGGAGG + Intergenic
1202484495 Y:25340496-25340518 ATGATCCAGGCTAAGCCAGGAGG - Intergenic