ID: 946865645

View in Genome Browser
Species Human (GRCh38)
Location 2:224039250-224039272
Sequence CTGCAGACGCCGCGCAGCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 202}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946865636_946865645 29 Left 946865636 2:224039198-224039220 CCAAGCGGCGGCGGCGAGGAGGG 0: 1
1: 0
2: 5
3: 23
4: 270
Right 946865645 2:224039250-224039272 CTGCAGACGCCGCGCAGCCCGGG 0: 1
1: 0
2: 0
3: 26
4: 202
946865642_946865645 0 Left 946865642 2:224039227-224039249 CCGGAAAGAGGCAGCGGTGGCGC 0: 1
1: 0
2: 1
3: 12
4: 123
Right 946865645 2:224039250-224039272 CTGCAGACGCCGCGCAGCCCGGG 0: 1
1: 0
2: 0
3: 26
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946865645 Original CRISPR CTGCAGACGCCGCGCAGCCC GGG Intronic
900163055 1:1233429-1233451 CTGGACACGGCGCGCTGCCCCGG - Exonic
900240829 1:1616415-1616437 CTGGAGCCGGCGGGCAGCCCCGG + Intronic
901007679 1:6179774-6179796 CTGCTGGCGCCGCGCGGCCAAGG - Intronic
904617120 1:31755960-31755982 CTGCAGACCCCGCCCCACCCAGG + Intronic
904825584 1:33271905-33271927 CTGCAGAGTCTGAGCAGCCCAGG + Intronic
910221402 1:84892924-84892946 CTGCAGGCGCCGCTGCGCCCCGG + Intronic
911091861 1:94023554-94023576 ATGCGGAAGCCGCCCAGCCCTGG + Intronic
912670430 1:111619826-111619848 CTGCTGTCGCCGCGCAGAGCCGG + Exonic
919838775 1:201594386-201594408 CTGCAGACCCCATGCAGCCTGGG - Intergenic
919916953 1:202144706-202144728 CTGCCGACGACTCGCTGCCCCGG + Exonic
920137431 1:203781368-203781390 CTGCAGGCTCCATGCAGCCCAGG - Intergenic
921688627 1:218121151-218121173 CTGCAGGCTGCGTGCAGCCCAGG + Intergenic
923573777 1:235140305-235140327 CCGCAAGCGCCGCGCAGCCCTGG - Intronic
924414908 1:243849628-243849650 CTCCCCACGCCGCGCGGCCCGGG + Intronic
924511152 1:244730192-244730214 CTGCGGGTGCCGCGGAGCCCTGG - Intergenic
1062874918 10:935279-935301 CTCCAGACGCTGCGCTGCTCTGG + Intergenic
1063224128 10:3998723-3998745 CTGCAGGCCCCATGCAGCCCAGG - Intergenic
1065968177 10:30785313-30785335 CTGCGGAGGCCGGGCGGCCCTGG - Intergenic
1069024118 10:63521599-63521621 CTGCAGCCGGCGCGAGGCCCAGG + Intronic
1069942447 10:71964715-71964737 CTGGAACCGCCGCCCAGCCCGGG + Intronic
1070167761 10:73911311-73911333 GTGCAGCCGCCGGGGAGCCCAGG - Exonic
1073073093 10:100807151-100807173 CTGCAGACACTGAGCAGCCCAGG + Intronic
1075076907 10:119357936-119357958 CAGCAGACGCTGCCCACCCCTGG - Intronic
1075537562 10:123283694-123283716 CCGCAAGTGCCGCGCAGCCCGGG + Intergenic
1075616533 10:123893864-123893886 CTGCAGAGGCAGCCCAGGCCAGG + Intronic
1077295404 11:1824060-1824082 CTGCAGGCGCTGGGCAGCCCTGG + Intergenic
1077368207 11:2169767-2169789 CTGCAGTCCCCTCGGAGCCCGGG - Exonic
1078613949 11:12847441-12847463 CTGCAGAGGCCTGGCAGCTCAGG + Intronic
1083129909 11:60615652-60615674 CTGCAGGCTCCGCGGAGCCATGG + Intergenic
1083303725 11:61752466-61752488 CTGCAGGCGGCGCTCAGCGCTGG - Intergenic
1083316421 11:61817173-61817195 CTGCGGCCACCCCGCAGCCCTGG - Intronic
1083768311 11:64852902-64852924 CTGCAGACTCCGAGCAGCGCTGG + Exonic
1083891869 11:65599597-65599619 CTGCAGCCGCCGGGAGGCCCAGG - Exonic
1084448372 11:69217747-69217769 CTGCTGGCGCCTCACAGCCCTGG + Intergenic
1085038320 11:73312645-73312667 CTGCAGAGGCTGGGCAGCCAGGG + Intronic
1085318764 11:75562019-75562041 CTCCCGGCGCCCCGCAGCCCGGG + Intergenic
1085504070 11:77046114-77046136 CTGCAGTACCCGCGCAGCCCCGG + Intergenic
1095455273 12:42377018-42377040 CTGCAGGCCGCGTGCAGCCCAGG + Intronic
1097168263 12:57097104-57097126 CTGCAGATGCCCCCCAGCCTGGG - Exonic
1100330116 12:93573435-93573457 CTGCAGCCGCAGCTCCGCCCGGG - Intronic
1102520680 12:113476062-113476084 CCGCCGCCGCCGCGCAGACCCGG - Intergenic
1103320005 12:120086970-120086992 CTACAGCCGCGGCGCAGCGCCGG - Intronic
1104692736 12:130839017-130839039 CTCCAGACGCCGCCCCGGCCGGG + Intronic
1104797174 12:131527971-131527993 CTGCAGCCGTCTCTCAGCCCAGG - Intergenic
1104857696 12:131909660-131909682 CCCCAGACGCTGCGAAGCCCGGG - Intronic
1104963914 12:132500648-132500670 CTGCAGACTCCATCCAGCCCGGG + Intronic
1104963931 12:132500706-132500728 CTGCAGACTCCGTCCAGCCCGGG + Intronic
1106504316 13:30357697-30357719 CTGCAGAGGCAGCGCTGCCCTGG - Intergenic
1109062412 13:57634329-57634351 CTGCAGGTGCCGCGCAACGCTGG + Exonic
1113747469 13:112754989-112755011 CTGCAGAGGCCACGATGCCCAGG - Intronic
1113782321 13:112983717-112983739 CTGCAGACACCACGCTTCCCCGG - Intronic
1114485187 14:23057711-23057733 CTGTATGCGCCCCGCAGCCCAGG - Intergenic
1117803047 14:59464687-59464709 CTGCCGCCGCCGCGGGGCCCTGG - Exonic
1121137415 14:91510722-91510744 CTGCGGACGCCGGGCAGCGTGGG + Intergenic
1122226856 14:100285443-100285465 CAGCGGACGCGGCCCAGCCCCGG - Intergenic
1122614596 14:103008370-103008392 CTGCAGCCACCCCACAGCCCTGG - Intronic
1123027818 14:105436614-105436636 CTGCAGACCCCGAGCTGCCAGGG + Intronic
1124109594 15:26773358-26773380 CTCCCGACTCCGCGCAGCCGCGG - Intronic
1124369175 15:29093777-29093799 CTGCAGAGGCCCGCCAGCCCAGG + Intronic
1128117661 15:65121131-65121153 CTGCAAACTCCACGCATCCCGGG + Intronic
1129458414 15:75687954-75687976 CAGCAGCCGCCGCCCACCCCGGG + Exonic
1132548824 16:545854-545876 CTGCCGAGGCGGCACAGCCCAGG - Intronic
1133031616 16:3013857-3013879 GTGCAGCCGCCGCCCAGCCCAGG - Exonic
1133303137 16:4795311-4795333 CAGCAGAGGCCGCCCAGCCCAGG - Intronic
1135077938 16:19410510-19410532 CACCAGACGCCGCGCAGGCCTGG - Intronic
1138228157 16:55316699-55316721 CTGCAGACTCAGCGCAGCATGGG + Intergenic
1141694505 16:85613288-85613310 CTGCCGCCGCCGAGCAGCCCCGG + Exonic
1142594311 17:1022220-1022242 CTGGAGGGGCCGCGGAGCCCAGG + Intronic
1142851067 17:2704988-2705010 CTGCAGCCCCCCTGCAGCCCAGG - Intronic
1145060421 17:19729767-19729789 CTGCTGACGCCCTGCAGTCCTGG + Intergenic
1146251718 17:31351772-31351794 CTGCAGGCCGCACGCAGCCCAGG + Intronic
1146952699 17:36917990-36918012 CTGGAGACACAGCACAGCCCTGG + Intergenic
1147123905 17:38352534-38352556 CTGCTGCCGCCCCGCAGGCCGGG + Exonic
1147740869 17:42670299-42670321 CTGCAGGCGCAGCGCCGCCAGGG + Exonic
1148284048 17:46372650-46372672 CTGCCCACCCCGCGCACCCCAGG + Intergenic
1148306269 17:46590571-46590593 CTGCCCACCCCGCGCACCCCAGG + Intergenic
1149530620 17:57392039-57392061 CTGCAGATGCAGAGCAGCCTGGG + Intronic
1150358419 17:64507224-64507246 CTTCAGACGCCGCGTCGCGCTGG + Intronic
1152722106 17:81928230-81928252 CAGCAGACCCCGAGCTGCCCAGG + Intergenic
1153526339 18:5998319-5998341 CTGCAGACGCAGCGCAGGGGAGG - Intronic
1153688092 18:7566840-7566862 CCGCAGCCGCCGAGCAGCGCAGG + Exonic
1154169310 18:12038945-12038967 GTGCTGTCGCCTCGCAGCCCAGG - Intergenic
1156171656 18:34493670-34493692 GTGCACATGACGCGCAGCCCCGG + Intronic
1157529331 18:48408776-48408798 CCGCAGGCGCCGCCGAGCCCCGG + Intronic
1158589632 18:58768630-58768652 GTGCAGACGGCGCTCAGACCGGG - Intergenic
1159586899 18:70289723-70289745 CTTCAGCCGCAGAGCAGCCCCGG - Intronic
1159670240 18:71212819-71212841 CCGCAAGCGCCGCGCAGCCCTGG + Intergenic
1160790294 19:919921-919943 CTGCAGTAGGCGCGCGGCCCGGG - Exonic
1161102595 19:2428618-2428640 CATCAGACGCCACCCAGCCCTGG - Exonic
1161585480 19:5103160-5103182 CTGCAGGCACCGGGCAGCCCTGG + Intronic
1161608867 19:5229845-5229867 CTGCACACCCCCCACAGCCCTGG + Intronic
1162101755 19:8343132-8343154 CTGGAAACGCAGCGCAGCGCCGG + Intronic
1163423165 19:17226457-17226479 CTGACGTCGCCGCGCAGCCTGGG - Intronic
1163532968 19:17861484-17861506 CTCCAGACCCCACGTAGCCCCGG - Intronic
1163655503 19:18543112-18543134 CTCCTGACGCCCCACAGCCCCGG + Intronic
1163672570 19:18637339-18637361 CTGCAGACGCCTCGAGGTCCTGG - Intronic
1164400179 19:27896668-27896690 CTGCAGCCTCAGAGCAGCCCAGG - Intergenic
1164404995 19:27936665-27936687 CTGCAGGCGCAGTGAAGCCCTGG + Intergenic
1165265675 19:34661741-34661763 CTGCAGGCCCCATGCAGCCCAGG + Intronic
1165311331 19:35030802-35030824 CAGCACGCGCCGCGCAGCCATGG + Exonic
1166010814 19:39941264-39941286 CTGCTGGCACCACGCAGCCCAGG - Intergenic
1166217940 19:41348337-41348359 CAGCAGACGCAGCTCTGCCCGGG + Exonic
1168505725 19:56933160-56933182 CTGCAGAAGCCGCGCAAACCAGG - Intergenic
1168721775 19:58558401-58558423 CTGCCGCCGCCGCGGGGCCCGGG + Exonic
925174201 2:1770889-1770911 CGGCAGCCGCCGCTCAGCCCCGG + Intergenic
925368478 2:3326960-3326982 CTGCAGAGGCCACGCAGCTTCGG - Intronic
929714423 2:44295908-44295930 CTTCAGACCCCGCGCAACCTGGG - Intronic
930011586 2:46941647-46941669 CTGCAGACGCTGAGCATGCCCGG + Exonic
931667367 2:64618941-64618963 CTGCAGGCCACGTGCAGCCCAGG + Intergenic
932580488 2:72990030-72990052 CGGCAGGCGCCTGGCAGCCCTGG - Intronic
934658953 2:96132931-96132953 CTGCAGCCTCCCTGCAGCCCAGG - Intronic
934704471 2:96467218-96467240 CTGCAGAGGCTGAGCAGCACGGG - Intergenic
935349655 2:102142575-102142597 CTGCGGACACCGCCCTGCCCCGG - Intronic
944172976 2:196799736-196799758 CTGCAGCTGCGGCGCAGACCGGG - Intergenic
944495833 2:200306773-200306795 CTCCGGACGGCGCGCGGCCCAGG + Intronic
944512452 2:200477895-200477917 CTGCAGACACCTCGGAGGCCAGG + Exonic
946190603 2:218005913-218005935 CTGCAGACTCTCCGCAGGCCTGG + Intergenic
946354863 2:219178294-219178316 CGGCGGCGGCCGCGCAGCCCTGG + Exonic
946865645 2:224039250-224039272 CTGCAGACGCCGCGCAGCCCGGG + Intronic
947669305 2:231926364-231926386 CAGCCGGCGCCGCGCAGCACTGG - Exonic
948298000 2:236877510-236877532 TTGCAGACGCCCCGAAACCCTGG + Intergenic
948456446 2:238106663-238106685 GTGCAGCCGCCGCTCATCCCAGG - Intronic
1172196696 20:33096787-33096809 CTGGTGACTCCGTGCAGCCCAGG - Intronic
1173785787 20:45792015-45792037 CTGGCGACGCCGAGCAGCCGCGG + Exonic
1174287728 20:49484078-49484100 CTGCAGGCGCCGCGGGGCCGGGG + Intergenic
1174607031 20:51768450-51768472 CCGCCGGCGCCGCGCCGCCCCGG + Exonic
1176069086 20:63216668-63216690 CTTCAGCCGCAGCGGAGCCCTGG + Intergenic
1176093242 20:63328269-63328291 CTGCACAGGCCTCGCATCCCCGG + Intronic
1176190711 20:63808364-63808386 AGGCAGACGCCACGGAGCCCGGG + Intronic
1176426003 21:6548562-6548584 CAGGAGCCGCCGTGCAGCCCAGG - Intergenic
1179701494 21:43156879-43156901 CAGGAGCCGCCGTGCAGCCCAGG - Intergenic
1179887376 21:44319934-44319956 CAGCAGACACCGCGCATGCCAGG - Intronic
1181048724 22:20228740-20228762 CTGCAGACCCCGCCAAGCCTGGG + Intergenic
1182364671 22:29770438-29770460 CTGCAGGCTGCACGCAGCCCAGG - Intergenic
1183653941 22:39174479-39174501 CTGCAGCCGCTGCTCACCCCCGG + Intergenic
1184679156 22:46061293-46061315 CTGCGGCCGGCGGGCAGCCCGGG - Intronic
1184997472 22:48219224-48219246 CTGCAGACGTCGCTGAGGCCGGG - Intergenic
1185238252 22:49726991-49727013 CTGCAGACGCCGTGATGCGCTGG - Intergenic
1185386034 22:50531683-50531705 CAGCAGACGACGTGCGGCCCCGG - Exonic
949281459 3:2352413-2352435 CTGCGAGCGCTGCGCAGCCCTGG - Intronic
949754462 3:7392933-7392955 CTGCAGCCGCTGCCCAGCCAAGG - Intronic
950023624 3:9806289-9806311 CTGCCGCCGCCGCGCTGCTCGGG - Exonic
950650294 3:14402879-14402901 CTGCAGACGGCGGGCAGCGCCGG - Intronic
953065285 3:39463896-39463918 CTGTAGACCCGGCGCAGCCCTGG - Intergenic
958641697 3:96814242-96814264 CTGCCCACGCCGCTCAGGCCAGG + Intergenic
965256756 3:166423996-166424018 CCGCAAGCACCGCGCAGCCCCGG - Intergenic
966096831 3:176213767-176213789 CCGCAAGCGCCGCGCAGCCCCGG + Intergenic
968405772 4:338079-338101 CCGCTGCCGCCGCTCAGCCCTGG + Intronic
968701416 4:2059728-2059750 ATGCACACGCCGCGCCCCCCCGG - Exonic
970182567 4:13415418-13415440 CTGCAAGCACCGCGCAGCCCCGG - Intronic
970374428 4:15442326-15442348 CTGCAAACTCCAGGCAGCCCCGG - Exonic
970394774 4:15655108-15655130 CTGCGGGCGCGGCGCAGGCCAGG + Intronic
971230893 4:24799730-24799752 CGCTGGACGCCGCGCAGCCCCGG + Exonic
971358192 4:25913626-25913648 GTGCAGAAGCCCCGCAGCTCCGG + Intronic
971382384 4:26110806-26110828 CTCCAGGTGCCGCTCAGCCCTGG + Intergenic
972671016 4:41214244-41214266 CAGCAGTGGCCGCGGAGCCCCGG + Intronic
973694506 4:53476823-53476845 CTGCAGCAGCCCAGCAGCCCTGG - Exonic
978340888 4:107720330-107720352 CCGCATGCGCCGCGCAACCCAGG - Exonic
979378042 4:119972198-119972220 CTGCAGGCCACGTGCAGCCCAGG - Intergenic
981429763 4:144645787-144645809 CTGCAGCAGCCGGGCAGTCCCGG + Intergenic
984095448 4:175427926-175427948 CGGCACTCCCCGCGCAGCCCTGG - Intergenic
985595052 5:784301-784323 CTCCAGACCCTGCCCAGCCCGGG - Intergenic
985727534 5:1523934-1523956 CTCCAGCCGCCGCGCATCCTCGG - Exonic
985888818 5:2700155-2700177 CTGTAGAAGCCACCCAGCCCTGG + Intergenic
987192682 5:15495150-15495172 CTGCAGGCGCCTGGCAGCCAAGG + Intergenic
987358194 5:17083481-17083503 CCGCAAGCACCGCGCAGCCCCGG - Intronic
987379988 5:17275813-17275835 CTGCAGAGGCTGCGGGGCCCTGG - Exonic
997585173 5:135039600-135039622 CCGCAGACGCAGCGCTGCCCAGG - Intronic
999322736 5:150625166-150625188 CTGGAGCCCCCACGCAGCCCAGG - Intronic
1001413096 5:171524575-171524597 CGGCAGACCCCGGCCAGCCCTGG + Intergenic
1002185862 5:177454609-177454631 CGGCCGCCGCCGCGGAGCCCGGG - Intronic
1002650927 5:180693078-180693100 CTGCAGCCTCAGCACAGCCCTGG + Intergenic
1002709205 5:181184120-181184142 CGCCAGACGCAGCGGAGCCCGGG - Intergenic
1003593686 6:7456382-7456404 CCGCAAGCGCCGCGCAGCCCCGG - Intergenic
1004224366 6:13772512-13772534 CCGCAAGCGCTGCGCAGCCCTGG - Intergenic
1007286921 6:40754618-40754640 CTGCTGACGCGGGGCTGCCCTGG + Intergenic
1007652759 6:43433391-43433413 CTGGAGACCCCACCCAGCCCAGG + Intronic
1016034875 6:139374802-139374824 CTGCAGAGGCTGCGGGGCCCGGG + Intergenic
1018034054 6:159866787-159866809 CTGCAGGGGCCACGCTGCCCGGG + Intergenic
1018733991 6:166673647-166673669 CTGCAGGCGGCACGCAGCCCAGG + Intronic
1018986398 6:168640403-168640425 CTGCAGACGCTGAGGGGCCCAGG + Intronic
1019190061 6:170246430-170246452 CTGCAGCCGCCCCCCAGCACCGG + Intergenic
1019190101 6:170246533-170246555 CTGCAGCCGCCCCCCAGCACCGG + Intergenic
1019190166 6:170246705-170246727 CTGCAGCCGCCCCCCAGCACCGG + Intergenic
1019190192 6:170246774-170246796 CTGCAGCCGCCCCCCAGCTCCGG + Intergenic
1019190217 6:170246843-170246865 CTGCAGCCGCCCCCCAGCACCGG + Intergenic
1019190231 6:170246878-170246900 CTGCAGCCGCCCCCCAGCACCGG + Intergenic
1019190284 6:170247015-170247037 CTGCAGCCGCCCCCCAGCACCGG + Intergenic
1019413877 7:918757-918779 GTGCAGACGCCCAGCTGCCCTGG + Intronic
1019667420 7:2258851-2258873 CAGCAAACGGCGGGCAGCCCTGG + Intronic
1020034936 7:4959074-4959096 CTGCCGCCGCCGCGCCCCCCAGG - Exonic
1020375380 7:7478882-7478904 CTGCAAGCGCCAGGCAGCCCTGG + Intronic
1025004635 7:55344441-55344463 CTGATGGCGCCGCGCAACCCCGG - Intergenic
1025901798 7:65750943-65750965 CTGCAGGCACCGTGCAGCCGCGG + Intergenic
1026000646 7:66557456-66557478 CTGGAGACCCCCTGCAGCCCAGG + Intergenic
1027001391 7:74657233-74657255 CTGCAAAAGCCGGGGAGCCCCGG - Intergenic
1027956020 7:84880603-84880625 CCGCAAGCGCCGCGCAGCCCGGG - Intergenic
1033662531 7:143412226-143412248 CTGCAGAGTCCCTGCAGCCCAGG + Intergenic
1034900195 7:154903507-154903529 CTGCAGACCCTGGGCTGCCCAGG - Intergenic
1035237549 7:157508689-157508711 CTGCAGACAGCACGCAGCTCAGG - Intergenic
1035367297 7:158357536-158357558 CTGCATTTGCTGCGCAGCCCAGG + Intronic
1035374148 7:158396099-158396121 CTGCAGAGGCAGCGAAGGCCGGG + Intronic
1035719429 8:1780577-1780599 CTGCTGCCGCCCCGGAGCCCCGG - Exonic
1037239537 8:16760846-16760868 CTGCAAGGGCTGCGCAGCCCCGG + Intergenic
1037686185 8:21141515-21141537 CTGCAGACTCTGCCCAGCCAAGG - Intergenic
1038326667 8:26577415-26577437 CGGCCGGCGCCGCGCAGCCCGGG - Intronic
1039711645 8:40061542-40061564 CTGCAAACACAGCCCAGCCCAGG + Intergenic
1043502808 8:80873845-80873867 CCGCCGCCGCCGCGCAGCGCCGG - Intronic
1045489180 8:102656051-102656073 CTGCAGTCGCCGCGCCTCCCCGG - Intergenic
1048583971 8:135755713-135755735 CTGGAGAAGCAGCACAGCCCTGG - Intergenic
1048981281 8:139704307-139704329 CTGCAGACCCAGCGCGGCGCAGG + Intergenic
1049401250 8:142428326-142428348 CTGCAGAGCCCGCTCAGCCCTGG - Intergenic
1049509138 8:143018905-143018927 CTCCAGTGGCTGCGCAGCCCTGG - Exonic
1049612117 8:143560631-143560653 CTGCAGCAGCTGCGCAGCCGCGG + Exonic
1049687151 8:143943585-143943607 CTGCAGAGCCCGCCCCGCCCTGG + Intronic
1051406763 9:16745971-16745993 CTGCAGAAGCCAAGGAGCCCAGG - Intronic
1053461748 9:38276950-38276972 CTGCAGATGCAGGGCAGCTCTGG - Intergenic
1056732608 9:89178645-89178667 CAGCGGCGGCCGCGCAGCCCCGG + Exonic
1057478644 9:95426804-95426826 CCGCAGCCGCCGCGCAGGCAGGG - Intergenic
1060793207 9:126499323-126499345 CTGCAGCAGCTGGGCAGCCCGGG - Intronic
1061300707 9:129703344-129703366 CTGCAGACTATGAGCAGCCCAGG + Intronic
1061378113 9:130238078-130238100 CCGCAGCAGCAGCGCAGCCCAGG - Intergenic
1061737199 9:132669868-132669890 CTCCAGACGTCCCCCAGCCCAGG - Exonic
1185642748 X:1597574-1597596 CTGCAGACACAGCCCAGGCCTGG + Intronic
1189294867 X:39910939-39910961 CTGCAGAGGCCGCAGGGCCCAGG + Intergenic
1190380626 X:49836947-49836969 CAGCAGATGCTGAGCAGCCCGGG - Intergenic
1190554304 X:51618269-51618291 CTGCAGAAGCTGTGCAGCGCCGG + Intergenic
1190560599 X:51682227-51682249 CTGCAGAAGCTGTGCAGCGCCGG + Intergenic
1190563692 X:51711094-51711116 CTGCAGAAGCTGTGCAGCGCCGG - Intergenic