ID: 946865828

View in Genome Browser
Species Human (GRCh38)
Location 2:224039902-224039924
Sequence CTGGGTTCCCAGGACGCTGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 316
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 282}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946865828_946865831 -9 Left 946865828 2:224039902-224039924 CCCGCAGCGTCCTGGGAACCCAG 0: 1
1: 0
2: 1
3: 32
4: 282
Right 946865831 2:224039916-224039938 GGAACCCAGCCCTTCTCAGCCGG 0: 1
1: 0
2: 1
3: 23
4: 225
946865828_946865837 8 Left 946865828 2:224039902-224039924 CCCGCAGCGTCCTGGGAACCCAG 0: 1
1: 0
2: 1
3: 32
4: 282
Right 946865837 2:224039933-224039955 AGCCGGTAACCACTGCTGCTGGG 0: 1
1: 0
2: 0
3: 15
4: 388
946865828_946865836 7 Left 946865828 2:224039902-224039924 CCCGCAGCGTCCTGGGAACCCAG 0: 1
1: 0
2: 1
3: 32
4: 282
Right 946865836 2:224039932-224039954 CAGCCGGTAACCACTGCTGCTGG 0: 1
1: 0
2: 0
3: 8
4: 182
946865828_946865839 14 Left 946865828 2:224039902-224039924 CCCGCAGCGTCCTGGGAACCCAG 0: 1
1: 0
2: 1
3: 32
4: 282
Right 946865839 2:224039939-224039961 TAACCACTGCTGCTGGGACCCGG 0: 1
1: 0
2: 2
3: 21
4: 207
946865828_946865841 29 Left 946865828 2:224039902-224039924 CCCGCAGCGTCCTGGGAACCCAG 0: 1
1: 0
2: 1
3: 32
4: 282
Right 946865841 2:224039954-224039976 GGACCCGGTGCGCGATAGACAGG 0: 1
1: 0
2: 0
3: 0
4: 53

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946865828 Original CRISPR CTGGGTTCCCAGGACGCTGC GGG (reversed) Intergenic
900165977 1:1244537-1244559 CTGGGGTCCCAGCTCTCTGCAGG - Intronic
900186896 1:1336934-1336956 CTGGGCTCCCAAGACGCAGTGGG + Intronic
900246383 1:1638106-1638128 CTGGGATCCCAGGTGGCTGTAGG - Intronic
900257612 1:1705248-1705270 CTGGGATCCCAGGTGGCTGTAGG - Intronic
900460854 1:2801602-2801624 CTGGGTCCCCAGGGCACAGCCGG - Intronic
900550212 1:3250833-3250855 CAGGCTTCCCAGGACGCTTCAGG - Intronic
900633559 1:3651312-3651334 CTGGGTTCTCTGGCCGCAGCGGG - Intronic
900945002 1:5826032-5826054 CTGGGTTCACAGTACCATGCTGG + Intergenic
902057792 1:13616780-13616802 CTGGATGCCGAGGAAGCTGCTGG + Exonic
902383688 1:16064625-16064647 TTGGGTTGCCAGGATGCTGACGG - Intronic
903232071 1:21927923-21927945 CAGGGTTCCCAGGGCACAGCCGG - Intronic
903300561 1:22375754-22375776 CTGTGTTCCCAGAACTCTACTGG - Intergenic
903329352 1:22589226-22589248 CTGGGGGACCAGGACGCTGCGGG - Intronic
903417532 1:23194114-23194136 TTGGGATCCCAGGACCCTCCAGG - Exonic
903501327 1:23801506-23801528 GTCGGTTCCCTGGACTCTGCGGG - Intergenic
903548429 1:24141483-24141505 CTGGGTTGCAAGGAGGCTGGTGG + Intronic
904545683 1:31269287-31269309 CTGGGTGCCCAGGAGGCCTCTGG - Intronic
904607201 1:31704358-31704380 CTGGGCCCCCAGAAGGCTGCGGG + Intergenic
905168899 1:36098670-36098692 CTGGGGTCCCAGGACTCTTGGGG - Exonic
905474668 1:38217704-38217726 CTGGGGTCCCTGGAGCCTGCAGG + Intergenic
905648368 1:39639959-39639981 CTGGGTCGCCTGGGCGCTGCTGG + Intergenic
905898566 1:41565639-41565661 CTGGGCTCCCAGGAGGAAGCTGG - Intronic
905912065 1:41662081-41662103 CTGGGCTGCCAGGCCGCGGCGGG + Intronic
906653881 1:47533767-47533789 CCGGGTTCCTAGGGCTCTGCAGG - Intergenic
907874314 1:58471153-58471175 CTGGGTTGCTAGGACAATGCTGG - Intronic
913259305 1:116984288-116984310 CTGGTATGCCAGGACACTGCAGG - Intronic
915637259 1:157195568-157195590 CTGGGCTCCCAGGTCACCGCAGG - Intergenic
915831766 1:159137846-159137868 CTGGAAAACCAGGACGCTGCTGG + Intronic
916092038 1:161314890-161314912 CTGGGTTCCCAGCGGGCTGCTGG + Intronic
918747444 1:188223020-188223042 CTGGGTTCCCAGTAATGTGCTGG - Intergenic
918863266 1:189860487-189860509 CTGAGATCCCAGGAGGGTGCTGG + Intergenic
919910859 1:202109919-202109941 CTAGGTTCCCAGGCCCCTGCAGG + Intergenic
920037965 1:203077682-203077704 TTGGGTTCCCATCATGCTGCTGG - Exonic
920826112 1:209425575-209425597 GTGTGTTCCCAGGAAGCTGCTGG - Intergenic
920845876 1:209592595-209592617 GTGGCTTACCAGGACCCTGCTGG - Intronic
921132351 1:212230487-212230509 CTGGATGCCCAGGACTCTGGAGG + Intergenic
921706188 1:218324345-218324367 GCGGGTTCCCAAGACGCGGCCGG + Intronic
921788528 1:219262857-219262879 CTGGTTAGCCAGGACGTTGCAGG + Intergenic
922932771 1:229403223-229403245 CTGTGTACCCAGCACTCTGCTGG - Intergenic
1062856629 10:783052-783074 CTGGGCTCCCAAGACGCACCCGG + Intergenic
1062990306 10:1808188-1808210 TTGGGTTCCCAGGACACTCACGG - Intergenic
1063906144 10:10782234-10782256 CTGGGTTGCCAGTTCACTGCTGG - Intergenic
1064271745 10:13871810-13871832 CTGGGTCCCCAGGTAGCTGGAGG - Intronic
1067017417 10:42768623-42768645 CTGGGATTACAGGACGCTGCAGG + Intergenic
1067767143 10:49095419-49095441 CTTGGTACCAAGGACCCTGCCGG - Intronic
1067822031 10:49539005-49539027 CTGGGTTCCAAGGCGGCTGGCGG - Exonic
1068769242 10:60802360-60802382 CTGTGATCCAAGGACACTGCAGG - Intergenic
1068827168 10:61453115-61453137 CTGCGCCCCCAGGACCCTGCCGG + Exonic
1069572834 10:69504762-69504784 CTGGGCACACAGCACGCTGCGGG - Intronic
1070325058 10:75383434-75383456 CTGGTCTCCCAGGACCCTGGAGG - Intergenic
1072739089 10:97898964-97898986 CTGAGTTCCCTGGGTGCTGCAGG + Intronic
1075965309 10:126606109-126606131 CTGGGTTCCCAGGGTGCAGTGGG - Intronic
1076619727 10:131779508-131779530 CAGGCTTCCCAGGACCCTGCAGG - Intergenic
1076739844 10:132477726-132477748 ATGGGATCCCAGGGGGCTGCGGG + Intergenic
1076794072 10:132790385-132790407 CTGGGTACCCCAGAAGCTGCCGG - Intergenic
1077479404 11:2806592-2806614 CTGCTTTCCGAGGAGGCTGCAGG + Intronic
1077504502 11:2923839-2923861 CTGGGTTTCCAAGCTGCTGCTGG - Intronic
1079021483 11:16912742-16912764 CTGGGTCCCCGGGAGGCTTCAGG + Intronic
1079374019 11:19875918-19875940 GTGGGTTCTGAGGAGGCTGCAGG + Intronic
1080567637 11:33526291-33526313 CTGGTTACCCAGGATGTTGCAGG - Intergenic
1081643403 11:44773799-44773821 CAGGGTTCCCAGGACGCCAGGGG - Intronic
1083307484 11:61768895-61768917 CTGTGTTTCCAGGAAGCTGTGGG + Intronic
1083367188 11:62148464-62148486 CTGGGTCCTCAGGGAGCTGCAGG + Exonic
1083637567 11:64128727-64128749 CTGGTTTCCCACGCCTCTGCTGG + Intronic
1083941958 11:65900593-65900615 CGGCGTTCCCCGGAGGCTGCGGG + Intergenic
1084110397 11:67010570-67010592 CTGGCTGCCCAGTACCCTGCTGG + Intronic
1084726295 11:70944420-70944442 CTGCTTTCTCAGGAAGCTGCTGG - Intronic
1084786333 11:71443861-71443883 CTGGGTTCCCGGGACCCAGCAGG - Intronic
1084857165 11:71996679-71996701 CTGGGCTCCCAGGTAGCTGAAGG + Exonic
1085052684 11:73387884-73387906 CTGGGTTCCCAGGCTGCCCCTGG + Intronic
1085345912 11:75768229-75768251 CTGGGTCCCCAGCACCCAGCAGG + Intronic
1085445434 11:76597919-76597941 CTGGGTTCCCTGACTGCTGCTGG - Intergenic
1085758337 11:79220059-79220081 CTGGATACCCAGGAACCTGCTGG + Intronic
1088598388 11:111456225-111456247 CGGGATTCCCAGGACTCAGCAGG - Intronic
1090028466 11:123187214-123187236 CTGGGCTCCCCAGACCCTGCTGG - Intronic
1090173188 11:124623046-124623068 CGGGGGCCCCAGGACGCTGCCGG - Exonic
1090205245 11:124880220-124880242 ATGGGTGCTCAGAACGCTGCGGG - Intronic
1091288836 11:134425390-134425412 CTGGATTGCCAGGAGGCTGGGGG - Intergenic
1091415217 12:276895-276917 CTGGGTTCTCAGGGAGATGCTGG - Intergenic
1091755700 12:3050047-3050069 CTTGGTTCCCAGAATGCTGGTGG - Intergenic
1094359524 12:29615250-29615272 CTGGCTTCTCAGGAAGCTCCAGG + Intronic
1095800921 12:46269264-46269286 CTGGGTTCCGAACACGCCGCCGG - Intronic
1096598654 12:52714298-52714320 CTGGGGTCCGAGGACGCCCCTGG + Intergenic
1096604432 12:52754514-52754536 CTGGCTTCTCAGGAGGCAGCAGG + Intergenic
1098243003 12:68487590-68487612 CAGGGTTCCCAGGACCCCGCGGG - Intergenic
1102518419 12:113465049-113465071 CTGAGATCCCAGGACTCAGCAGG - Intronic
1103222239 12:119255473-119255495 CTGGGGTCCCAGGGGACTGCTGG - Intergenic
1105547439 13:21361209-21361231 CTGGGATCACACGACCCTGCAGG + Intergenic
1105989015 13:25599727-25599749 CTGGGTTCCAGGGACGAGGCAGG + Intronic
1106060005 13:26281107-26281129 CTGGTTGCCCAGGATGTTGCAGG - Intronic
1110379059 13:74828589-74828611 CTGAGTCCCCAGGCCACTGCTGG - Intergenic
1114551308 14:23534259-23534281 CTGGGGTCCCAGGTGGCTGTGGG + Exonic
1116406140 14:44568298-44568320 CTGGTTACCCAGGATGTTGCAGG - Intergenic
1118030335 14:61812582-61812604 CTGGGCTCTCAGGACGCCGGCGG + Intergenic
1121097599 14:91228690-91228712 CTGAGTTCTCAGGATGCTGGAGG - Intergenic
1121518079 14:94567043-94567065 CCGGGTGCCCATGATGCTGCAGG + Exonic
1122638342 14:103141198-103141220 CTGGCATCTCAGGAGGCTGCGGG - Intergenic
1123053387 14:105558693-105558715 CTGGGAGCCCAGGAGGCTGCCGG + Intergenic
1123077964 14:105679107-105679129 CTGGGAGCCCAGGAGGCTGCCGG + Intergenic
1124019327 15:25904897-25904919 CTGGGTACCCAGGAAACTGCAGG - Intergenic
1124438364 15:29669633-29669655 CTGGTTCCCCAGGAGGCTCCTGG + Intergenic
1124475350 15:30028414-30028436 CTGGGGTCCCAGTGGGCTGCAGG + Intergenic
1125721010 15:41845154-41845176 CTGGGCACCCAGGCCGCTGTGGG + Intronic
1126048237 15:44663954-44663976 CTGGGTTCCAAGGGAGCTGGAGG - Intergenic
1128300467 15:66563742-66563764 CTGGGCTCCCAGAATGCTGGTGG - Intronic
1128458510 15:67847842-67847864 CAGGGTTCTCAGGACCATGCTGG + Intergenic
1128525364 15:68408617-68408639 CTGGGTGCTCAGGAAGCTTCTGG + Intronic
1128539825 15:68518706-68518728 CAGGGTTCCCAGGAAGCCCCTGG - Intergenic
1128686119 15:69687013-69687035 CTGGGTTTCCAGGAAGCTCTGGG + Intergenic
1129452550 15:75659084-75659106 CTGGGTACCCAGGACGGTTTGGG - Exonic
1129595578 15:76961376-76961398 CTGCCTTCACAGGAAGCTGCAGG + Intergenic
1130552062 15:84895547-84895569 CTGTTGTCCAAGGACGCTGCTGG - Intronic
1131260242 15:90884220-90884242 CGGTGTTCCCGGGGCGCTGCCGG + Intronic
1131511869 15:93053653-93053675 CTGGGTTCACACAAGGCTGCTGG - Intronic
1132320148 15:100919497-100919519 CTGGGTTCCCCGGGCGGGGCCGG - Intronic
1132750635 16:1455863-1455885 CTGGGTTCCCTGGAGCCTGGGGG - Intronic
1132933691 16:2471012-2471034 CTGTGGGCCCAGGACCCTGCTGG + Intergenic
1136178219 16:28533171-28533193 CTGAGTTACCAGGATGCTGCTGG - Intronic
1136656211 16:31710851-31710873 CTGGGGTCCCAGGAGGATGGTGG - Intergenic
1136776213 16:32873176-32873198 CTGGGCTCTCAGGAAGCAGCAGG - Intergenic
1136894402 16:33988336-33988358 CTGGGCTCTCAGGAAGCAGCAGG + Intergenic
1137568750 16:49550952-49550974 CTGGGTTTGCAGGAAGCTGCTGG + Intronic
1138383073 16:56617189-56617211 CTGGGTTCCCGGAACGCTCGGGG + Intergenic
1139340931 16:66267457-66267479 CTGGGTGGCCAGGACCCGGCCGG + Intergenic
1141154235 16:81585955-81585977 CATGGTGCCCAGGGCGCTGCCGG + Intronic
1141162755 16:81640098-81640120 CTGGGGACCCAGGAGGCTACAGG - Intronic
1141478851 16:84292840-84292862 CTGGGTTTACAGGACTCTGATGG + Intergenic
1142126237 16:88411999-88412021 CTGGGGTCCCAAGACCCTGTTGG + Intergenic
1203078628 16_KI270728v1_random:1135285-1135307 CTGGGCTCTCAGGAAGCAGCAGG - Intergenic
1143487242 17:7261706-7261728 CTGGGTTGCCGGGGAGCTGCAGG - Intronic
1144042203 17:11422092-11422114 CTGGCTTCCCAGGTGGCTGCCGG - Intronic
1144672515 17:17140942-17140964 CTTGGTGCCCTGGAAGCTGCAGG - Intronic
1144955667 17:19017705-19017727 CAGGGTTTCCAGGAGGCTGTGGG - Intronic
1148069412 17:44899386-44899408 AAGAGTTCCCAGGCCGCTGCCGG + Exonic
1148763693 17:50023142-50023164 CTTGGTTCCCAGGAAGATGGTGG + Intergenic
1148876332 17:50689646-50689668 CTTGGCTCCCAAGACACTGCTGG - Intronic
1149303220 17:55324576-55324598 CTGGGGTCTCAGCACCCTGCAGG + Exonic
1150608579 17:66714761-66714783 CTGGTGTCCCAGACCGCTGCTGG + Intronic
1150765031 17:67995762-67995784 CCGGGCTCGCAGGACGCCGCGGG - Intergenic
1151826832 17:76528475-76528497 CTGGGTGCCAAGGAAGCTGGAGG - Exonic
1152605298 17:81286582-81286604 CTGGGTCCCCGGGACCTTGCTGG - Intronic
1152666056 17:81570307-81570329 CTGGGTGCCCAGCACGGGGCTGG + Intronic
1152755157 17:82084143-82084165 CTGCATCCCCAGGACGCTGGAGG - Exonic
1160659174 19:290599-290621 CTTTGTTCCCGGGACCCTGCGGG + Intronic
1160864829 19:1251982-1252004 CTGTGCTCCCAGGAGGCTGGGGG + Intronic
1161556262 19:4944454-4944476 CTGGAGCCCCGGGACGCTGCAGG - Intronic
1161577282 19:5061268-5061290 CGAGGCTCCCAGGACTCTGCTGG + Intronic
1162154142 19:8665147-8665169 CTAGGTTCCCAGGACCCAGTGGG - Intergenic
1162337519 19:10071014-10071036 TCGGGTTCACAGGATGCTGCAGG + Intergenic
1162771921 19:12954215-12954237 CTGGGTGCCCCAGAGGCTGCTGG + Exonic
1162789215 19:13054433-13054455 CTGGGTTCCTAGGGGGCTGGAGG + Intronic
1162795021 19:13082515-13082537 AAGGGTTCCCAGGACGGTCCTGG + Intronic
1163233522 19:16018775-16018797 CTGGGTCCCAGGGACGCTGTAGG + Intergenic
1163321040 19:16574995-16575017 CTGTGTTCTCAGGACGCAGAAGG - Exonic
1163372729 19:16910888-16910910 CTGGGGTCCCTGGAAGCTGGAGG + Intronic
1163838924 19:19593797-19593819 CTGAGTCCCAAGGCCGCTGCAGG - Intronic
1165069951 19:33249340-33249362 GCGGGTGCCCAGGAGGCTGCGGG + Intergenic
1166239829 19:41482620-41482642 CTGGATTCCCTGGAGCCTGCAGG - Intergenic
1166257972 19:41619620-41619642 CTGGGTCCCCTGGAGCCTGCGGG + Intronic
1166836127 19:45669107-45669129 CCGGGTTCCCAGGAGTCTGTAGG + Intronic
1167633376 19:50639455-50639477 CTGGGGTCCCAAGACGCTTCAGG + Intronic
1167792595 19:51690858-51690880 CTGGGTTCCCAGCATGCCCCGGG - Intergenic
1168148127 19:54430699-54430721 CTGGGTTCCGGGGAGGATGCAGG + Intronic
925510031 2:4615226-4615248 CTGGGTTCCCATTACTCTACAGG + Intergenic
925640437 2:5981575-5981597 CGGGGATCACAGGATGCTGCCGG - Intergenic
926144940 2:10391186-10391208 CTGGGCCCCCAGGAAGGTGCTGG - Intronic
929061233 2:37926028-37926050 CAGGTTTTCCAGGACGCTGTAGG + Intronic
930089229 2:47519858-47519880 CTGGTTCCCAAGGACGCAGCTGG + Exonic
932706659 2:74031264-74031286 CTGGGTTTCCGTGACCCTGCCGG - Intronic
933374982 2:81467490-81467512 CTGCGTCCCCAGCTCGCTGCAGG + Intergenic
933761414 2:85674791-85674813 CTGTGTTCCCAGCACCATGCTGG - Intergenic
934579564 2:95427450-95427472 CTGGTGTCCCGGGACGCTGCAGG + Intergenic
934599880 2:95649275-95649297 CTGGTGTCCCGGGACGCTGCAGG - Intergenic
934618307 2:95789050-95789072 CTGTGTTCCCAGCACCCAGCAGG - Intergenic
934642586 2:96035509-96035531 CTGTGTTCCCAGCACCCAGCAGG + Intronic
936250511 2:110864881-110864903 CTGGCTGGCCAGGACGCTCCAGG - Intronic
936974383 2:118204660-118204682 GGGGGTTCCCAGGAGGCAGCAGG - Intergenic
937070517 2:119059757-119059779 CAGGGTTCCCAGCAGACTGCTGG - Intergenic
937872042 2:126792866-126792888 CTGGGTGCCAAGGATGGTGCAGG + Intergenic
938293111 2:130160812-130160834 CTGGGTTCACTGCACTCTGCAGG - Intronic
938463443 2:131512153-131512175 CTGGGTTCACTGCACTCTGCAGG + Intergenic
944571978 2:201054063-201054085 CTGGATTCCCAGGAAGTTGTTGG - Intronic
944858617 2:203792497-203792519 TTTGGTTCCCAGGAGGCTGAAGG + Intergenic
946865828 2:224039902-224039924 CTGGGTTCCCAGGACGCTGCGGG - Intergenic
947460104 2:230296694-230296716 CTGTGGTCCCAGGAGGCTGTGGG + Intronic
947640420 2:231704663-231704685 CTGGCTTCTCAGGAGGCTGAGGG + Intergenic
948218086 2:236246530-236246552 CTGTGTGCCTAGGACCCTGCTGG + Intronic
948922019 2:241070277-241070299 CTGGCATCCCAGGCCCCTGCAGG - Intronic
949043788 2:241861032-241861054 GTGGGGTCCCAGGACCCTGTAGG - Intergenic
949066753 2:241995657-241995679 CGGCGTTCCCAGGATGCAGCTGG + Intergenic
1169201528 20:3712554-3712576 CTGGCTCCCCAGGGCTCTGCCGG + Intergenic
1169397866 20:5250836-5250858 CTGGTTAGCCAGGATGCTGCAGG + Intergenic
1170157767 20:13284319-13284341 CTGGGTTTCAAGGATGCCGCTGG - Intronic
1170842451 20:19935024-19935046 CTGAGTTCCCCGGGCGCTGTGGG + Intronic
1171448106 20:25218751-25218773 CTGGGTGCCCAGCATGCAGCGGG - Intronic
1171870694 20:30522174-30522196 GTGGGTTGCAAGGATGCTGCTGG - Intergenic
1172962384 20:38807667-38807689 CTGAGTCCCCAGGATGCTGGGGG + Intronic
1173152279 20:40577716-40577738 CTGGATGCCCAGGAAGCTTCTGG - Intergenic
1174048135 20:47748228-47748250 CAGGTTTCCCAGGACGTTGGAGG - Intronic
1174453915 20:50636483-50636505 CTGGGTAACCAGCACTCTGCAGG + Intronic
1174741922 20:53022967-53022989 CTGGTTTTCCAGGACTCTGCTGG + Intronic
1175903323 20:62368382-62368404 CTGGGTTCCCTGGACAGTCCCGG + Intergenic
1176139688 20:63539544-63539566 CTGGGCTCCCAGGAGGGTGGGGG + Intergenic
1178233397 21:30813173-30813195 CTGTCTTCCCAGGATGCTACTGG - Exonic
1179026188 21:37680727-37680749 CTGGGTCTCCAGGAAACTGCAGG + Intronic
1179128299 21:38611775-38611797 CTGGGTGCCGAGGATGCAGCGGG - Intronic
1180987522 22:19913653-19913675 CTAGGTTCCCAGGAATATGCTGG - Intronic
1181010378 22:20036884-20036906 CTGGGCACCCAGGACCCTGCAGG - Exonic
1181379969 22:22494249-22494271 CTGGGTTCTAATGACACTGCTGG + Intronic
1184160868 22:42696612-42696634 CTAGGTTCCCAGCACGCAGCAGG + Intronic
1184547401 22:45180633-45180655 CTGTAATCCCAGCACGCTGCAGG - Intronic
1185275921 22:49950221-49950243 CTGGGTCCCCAGGACGGTGCAGG - Intergenic
952891969 3:38049207-38049229 CTGGTTTCTCAGGTCTCTGCTGG + Intronic
954164709 3:48747389-48747411 CTGTGTGCCCAGGGTGCTGCTGG + Exonic
954635192 3:52067342-52067364 CTGGGTCACCAGGACCCAGCTGG + Intergenic
956101830 3:65776577-65776599 CTGGTTTTCCAGGCAGCTGCAGG + Intronic
960545688 3:118912319-118912341 CTTGGTTGCCAAGAAGCTGCAGG + Intronic
960995573 3:123338143-123338165 GTAGATTCCCAGGAGGCTGCAGG - Intronic
960995709 3:123338910-123338932 CTGGGTGTCCAGGGTGCTGCAGG - Intronic
961426266 3:126850986-126851008 CTGGATCCCCAGGCAGCTGCAGG - Intronic
961513818 3:127420566-127420588 CTGGGAACCCAGCACTCTGCTGG + Intergenic
962751006 3:138434830-138434852 CTGGGCTCCCAGGGCGCTGGGGG - Exonic
966553367 3:181230341-181230363 CTGGTTAGCCAGGACGTTGCAGG + Intergenic
966834745 3:184040514-184040536 CTCAGTTTCCAGAACGCTGCCGG + Intergenic
968977087 4:3827677-3827699 CAGGGCTCCCAGGTCACTGCAGG - Intergenic
969140909 4:5070798-5070820 CTGGGTGCTCAGGACACTGATGG - Intronic
969257434 4:6011769-6011791 CTGAGTTCCCACGGCTCTGCTGG + Intergenic
969292783 4:6251533-6251555 CTGGGTTCCCACATCCCTGCAGG - Intergenic
969704857 4:8786149-8786171 CTGGGCTCCCAGGGCTCTGCTGG - Intergenic
971257839 4:25030513-25030535 CTGGGTGCCCAGGATCGTGCCGG - Exonic
973954502 4:56049389-56049411 CTGGAGTCCCGGGGCGCTGCGGG - Intergenic
982187211 4:152814765-152814787 CTGGGTACCCTGGCCACTGCTGG + Intronic
985262462 4:188127799-188127821 CTGGGTTCCCAGGCAGCTGGAGG - Intergenic
985299547 4:188473328-188473350 CTGGGTTCTCAGGTCCCTGGAGG + Intergenic
985768523 5:1794845-1794867 CTGGGTTCCCAGAACCCTGTGGG + Intergenic
987124033 5:14794285-14794307 CTGGGCACACAGGAAGCTGCAGG - Intronic
987903884 5:24050850-24050872 CGGGGACCCCAGGACTCTGCTGG - Intronic
989582153 5:43043075-43043097 CTGGCTTCGCAGGACGCAACGGG + Exonic
990978364 5:61578860-61578882 CTGGGAGGCCAGAACGCTGCTGG + Intergenic
994213174 5:97108610-97108632 CTGGGTTCACAGGAGCCTGTAGG - Intronic
997210507 5:132074260-132074282 CTGGGTGCTCAAGAGGCTGCTGG + Intronic
998071014 5:139198154-139198176 GTGGGTCCCCAGAACACTGCTGG + Intronic
1000382093 5:160638432-160638454 CTGTGTCCCCAAGATGCTGCAGG - Intronic
1001180350 5:169514348-169514370 CTGGGTTCTCAGTAGGCTGTAGG + Intergenic
1001526172 5:172430371-172430393 CTGTGTTCCCAGGACTATGGGGG - Intronic
1001890766 5:175336329-175336351 CTGGGGTAGCAGGACACTGCTGG - Intergenic
1002342274 5:178524889-178524911 CTGGGAGCCCAGCACTCTGCGGG + Intronic
1003404238 6:5815477-5815499 CTGGGTTCACATGACCTTGCAGG - Intergenic
1005215547 6:23523275-23523297 CTGGGTTTCCAGGAAGGAGCAGG - Intergenic
1006326287 6:33356436-33356458 CTGAGTCCCCAGGTGGCTGCAGG + Intergenic
1006470274 6:34224598-34224620 CTGGTTCCCCCGGGCGCTGCAGG - Intergenic
1007091133 6:39185577-39185599 CTGGGCTCCCAGGAATCTGAAGG + Intergenic
1007339148 6:41179424-41179446 CTGGAGTCCCAGGAGGCTTCAGG - Intergenic
1007422545 6:41728427-41728449 CTGCCTTGCCAGGACGGTGCTGG - Intronic
1008630451 6:53359228-53359250 CTGGGTTCCCGGAACGCGGTGGG + Intergenic
1012480219 6:99658522-99658544 TGGGGTTCCCAGTACCCTGCTGG + Intergenic
1012854414 6:104484868-104484890 CCCTGTTCCCAGGACCCTGCAGG + Intergenic
1017714561 6:157200080-157200102 CTTGCTTCCCAGGATGCTCCGGG - Intronic
1018353492 6:162987883-162987905 CTGGTTATCCAGGATGCTGCAGG + Intronic
1019492714 7:1322630-1322652 CTGGGCTCCCAGGACCCAGGCGG - Intergenic
1019634639 7:2069047-2069069 CTGGGTTGCCAGGAGGGTTCTGG - Intronic
1020106109 7:5423148-5423170 CTCGGTTCCCAGCAGGCGGCGGG - Intronic
1020153463 7:5702054-5702076 CTGAGGCCCCAGGTCGCTGCCGG + Intronic
1022050382 7:26662812-26662834 CTGGGTTCCCAGAAAGCAGAGGG + Intergenic
1022307309 7:29159336-29159358 CTGTGATGCCAGGATGCTGCAGG - Intronic
1022687298 7:32608830-32608852 CTGTGTGGCCAGGACGCTGTAGG + Intergenic
1023138127 7:37074527-37074549 CTGGGTTCCCAGGAGGGCGAGGG + Intronic
1024103723 7:46059615-46059637 CTGGGTTCCCAGGGGCCTGTGGG + Intergenic
1024328007 7:48127545-48127567 CTGGTTTTCCAGGATGTTGCAGG + Intergenic
1025149839 7:56539502-56539524 CCTGGTGCCCAGGACTCTGCGGG - Intergenic
1025799671 7:64774074-64774096 CTGGGTTACAAGGATGCTGCTGG + Intergenic
1027131072 7:75591853-75591875 CTGGGGTCTCTGGACGCTTCAGG - Intronic
1029513154 7:101009364-101009386 CTGTGTTCCCAGCACCCAGCAGG - Intronic
1031980030 7:128118877-128118899 CTGGATACCCAGGCCTCTGCTGG + Intergenic
1032019113 7:128396751-128396773 CTGGGGTCCCAAGAGGCTGTTGG - Intronic
1032398108 7:131605299-131605321 CTGGGTTCTGAGGACTCTGCAGG - Intergenic
1032534916 7:132655212-132655234 CTGTGTCCCCAAGACGCTGTGGG - Intronic
1032548388 7:132762281-132762303 CTGGGTTCACAGCAAGGTGCTGG + Intergenic
1033663342 7:143418795-143418817 CGGGGTTTCCAGGACTGTGCAGG + Intergenic
1034140029 7:148806777-148806799 CAGGGTTCCCATGATGCTGCTGG + Intergenic
1034344635 7:150379020-150379042 CAGGGGTGCCAGGACGCCGCCGG + Intronic
1034567118 7:151924201-151924223 CTGGGTACCCTGGCCACTGCTGG + Intergenic
1034829815 7:154299261-154299283 CTGAGGTCCCTGGAAGCTGCTGG - Intronic
1035051055 7:155999260-155999282 GTGGGTTCCCAGGGCGGGGCGGG + Intergenic
1035797903 8:2376236-2376258 CTGAGATGCCAGGACGCTGTTGG - Intergenic
1037963807 8:23118091-23118113 CAGGGTCCCCAGTACGCAGCTGG - Intergenic
1038565479 8:28616781-28616803 CAGGGTTCCCAGGAAACAGCTGG + Intronic
1038931291 8:32196577-32196599 CTCTGTTCCCAGGGCTCTGCTGG - Intronic
1043591779 8:81841886-81841908 CTGTGATCCCAGGGAGCTGCGGG - Intronic
1043876609 8:85493011-85493033 CAGGGTGCCCAGGACTGTGCTGG - Intergenic
1043928843 8:86068278-86068300 CTGGCTTCCCAAGGCACTGCTGG - Intronic
1044545058 8:93449921-93449943 TTGGCTTCCCAGGAAACTGCAGG + Intergenic
1045751154 8:105485402-105485424 CTGGGTTCTCTGGAGGCTGAGGG + Intronic
1046531331 8:115449817-115449839 CTGGGTTCCCATCAGACTGCTGG + Intronic
1049264378 8:141659612-141659634 CTGGCTTCCCAGGGAGCTGCTGG - Intergenic
1049332744 8:142063833-142063855 GGGGGTTCCCAGGCTGCTGCCGG - Intergenic
1049361453 8:142214174-142214196 CTGGGTTCCCAGGGCCAGGCGGG - Intronic
1049405860 8:142451604-142451626 GTGGGTTCCCAGGATGGAGCGGG - Intronic
1049488655 8:142879507-142879529 CTTGCTGCCCAGGACCCTGCCGG - Intronic
1049709038 8:144055482-144055504 CTGGGCTCCCAGCAAGCCGCTGG + Intronic
1049799803 8:144512512-144512534 CTGGGTCCTCAGGCAGCTGCTGG + Exonic
1049843556 8:144788995-144789017 GTGGGGTCCCAGGTCACTGCTGG - Intergenic
1051666148 9:19468476-19468498 CTGGGTTCCCATGAGGCCTCTGG + Intergenic
1055986731 9:82061339-82061361 GTGTGTCCCCAGGAGGCTGCAGG + Intergenic
1056757212 9:89389235-89389257 CTTGGATCCCAGAACGCTCCTGG + Intronic
1056768750 9:89461645-89461667 CAGGCTTCCCAGGACTCTGGGGG - Intronic
1058110673 9:101028546-101028568 CGGGGTTCCCAGAAGGCAGCGGG - Intergenic
1060724349 9:125997267-125997289 CCGGGCTCCCAGGACCTTGCAGG - Intergenic
1061057893 9:128233861-128233883 CTAGGGTCCCAGGACGCTGATGG - Intronic
1061702046 9:132423345-132423367 CTGGGTTTCCAGGAGGCTCCTGG + Intronic
1061832478 9:133304566-133304588 ATGGGGGCCCAGGGCGCTGCAGG - Intergenic
1191077247 X:56468542-56468564 CTGGTTACCCAGGATGTTGCAGG + Intergenic
1191634718 X:63363290-63363312 CTGGCTCCCCAGTACACTGCAGG + Intergenic
1191784488 X:64903228-64903250 CTGGTTAGCCAGGACGTTGCAGG + Intergenic
1192886271 X:75337713-75337735 CTGGTTAGCCAGGATGCTGCAGG + Intergenic
1195814421 X:108869457-108869479 CTTGGTTCCCAGGATGGAGCAGG - Intergenic