ID: 946865900

View in Genome Browser
Species Human (GRCh38)
Location 2:224040280-224040302
Sequence GAGTGTGCACGTGTGTGTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1748
Summary {0: 1, 1: 1, 2: 26, 3: 175, 4: 1545}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946865890_946865900 14 Left 946865890 2:224040243-224040265 CCTGCAGTCACCCCTTGGCATGC 0: 1
1: 0
2: 12
3: 50
4: 235
Right 946865900 2:224040280-224040302 GAGTGTGCACGTGTGTGTTGGGG 0: 1
1: 1
2: 26
3: 175
4: 1545
946865895_946865900 2 Left 946865895 2:224040255-224040277 CCTTGGCATGCAGGTGGCCGTGC 0: 1
1: 0
2: 0
3: 35
4: 273
Right 946865900 2:224040280-224040302 GAGTGTGCACGTGTGTGTTGGGG 0: 1
1: 1
2: 26
3: 175
4: 1545
946865894_946865900 3 Left 946865894 2:224040254-224040276 CCCTTGGCATGCAGGTGGCCGTG 0: 1
1: 0
2: 1
3: 10
4: 176
Right 946865900 2:224040280-224040302 GAGTGTGCACGTGTGTGTTGGGG 0: 1
1: 1
2: 26
3: 175
4: 1545
946865893_946865900 4 Left 946865893 2:224040253-224040275 CCCCTTGGCATGCAGGTGGCCGT 0: 1
1: 1
2: 3
3: 20
4: 165
Right 946865900 2:224040280-224040302 GAGTGTGCACGTGTGTGTTGGGG 0: 1
1: 1
2: 26
3: 175
4: 1545
946865888_946865900 30 Left 946865888 2:224040227-224040249 CCACTTGGAAGATCAGCCTGCAG 0: 1
1: 0
2: 1
3: 22
4: 152
Right 946865900 2:224040280-224040302 GAGTGTGCACGTGTGTGTTGGGG 0: 1
1: 1
2: 26
3: 175
4: 1545

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946865900 Original CRISPR GAGTGTGCACGTGTGTGTTG GGG Intergenic
900137404 1:1123861-1123883 GTGTGTGCAGGTGTGTGCTCAGG - Intergenic
900137428 1:1124138-1124160 GTGTGTGCAGGTGTGTGCTCAGG - Intergenic
900187858 1:1340818-1340840 GTGTGTGCAGGTGTGTGTGCAGG - Intronic
900222889 1:1518731-1518753 GACTGTGCCCATGTGTGTGGGGG - Intronic
900295253 1:1945861-1945883 GTGTGTGCACGTGTGTGTGTGGG + Intronic
900295258 1:1945927-1945949 ATGTGTGCACGTGTGTGTGGGGG + Intronic
900392021 1:2437834-2437856 GTGTGTGCACGTGTGTGGTTTGG - Intronic
900526030 1:3129114-3129136 GAGTGTGCACGTGCGTGTGTGGG + Intronic
900563694 1:3321663-3321685 GTGGGTGCACGTGTGTGTGTGGG + Intronic
900563724 1:3322217-3322239 GCATGTGCACGTGTGTGTGTGGG + Intronic
900581096 1:3409881-3409903 TTGTGTGCATGTGTGTGGTGTGG + Intronic
900581101 1:3409923-3409945 GTATGTGCATGTGTGTGGTGTGG + Intronic
900596454 1:3482289-3482311 CTGTGTGTGCGTGTGTGTTGGGG + Intergenic
900796262 1:4710446-4710468 GAGTGTGTACGTGTGTGACTGGG - Intronic
900818955 1:4871568-4871590 GTGTGTGCATGTGTGTGTACAGG - Intergenic
900901094 1:5516540-5516562 GTGTGTGTGTGTGTGTGTTGTGG - Intergenic
901022809 1:6263539-6263561 CTGTGAGCACGTGTGTGGTGAGG - Intergenic
901205493 1:7492892-7492914 GTGTGTGCACGTGTGTATGTAGG - Intronic
901520247 1:9778219-9778241 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
901777718 1:11571733-11571755 AAGTGTGCATGTGTGTGTGCAGG - Intergenic
902074955 1:13777067-13777089 CTGTGTGCATGTGCGTGTTGTGG - Intronic
902217378 1:14943034-14943056 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
902239906 1:15081574-15081596 GTGTGTGAGTGTGTGTGTTGGGG + Intronic
902332803 1:15738777-15738799 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
902734967 1:18394415-18394437 GAGGGTGCACATATGTGTTGGGG - Intergenic
902741529 1:18441941-18441963 GTGTGTGTGTGTGTGTGTTGCGG + Intergenic
902987565 1:20164420-20164442 GCGTGTGCATGTGTGTGTTTAGG + Intronic
903007784 1:20309939-20309961 GTGTGTGTGTGTGTGTGTTGCGG + Intronic
903283929 1:22265614-22265636 AAGTGTGCATGTGTGTGCAGGGG - Intergenic
903589792 1:24446090-24446112 GTGTGTGTGTGTGTGTGTTGTGG + Intronic
903644840 1:24888604-24888626 GAGGCTACAGGTGTGTGTTGAGG + Intergenic
903834886 1:26197501-26197523 GAGAGTACACGTGTGTTTTGTGG + Intronic
903883651 1:26529411-26529433 CAGTGTGAATGTGTGTGCTGGGG + Intergenic
904346774 1:29877746-29877768 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
904497331 1:30894398-30894420 GAGTGAGAATGTGTGTGTGGGGG + Intronic
904692092 1:32301055-32301077 GAGTGAGTGTGTGTGTGTTGTGG + Intronic
905352783 1:37359114-37359136 GATTGTGTGTGTGTGTGTTGGGG + Intergenic
905516249 1:38564172-38564194 GAGTGTGCATGTGTGTGAGGAGG + Intergenic
905867843 1:41385929-41385951 GTGTGTGCGTGTGTGTGTGGTGG + Intergenic
905892559 1:41526463-41526485 GAGTGTGAAGGTGAGTGTGGGGG - Intronic
905971647 1:42146341-42146363 GAGTGCTCTCGTGTGTGTAGGGG - Intergenic
906542683 1:46599990-46600012 GGGTGTGTGTGTGTGTGTTGTGG - Intronic
906733143 1:48100447-48100469 GTGTGTGCATGTGTGTAGTGGGG + Intergenic
906786441 1:48619994-48620016 ATGTGTGCATGTGTGTTTTGGGG - Intronic
906875715 1:49536376-49536398 TCATGTGCATGTGTGTGTTGGGG + Intronic
906929216 1:50152407-50152429 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
907311043 1:53539213-53539235 GTGTGTGTTGGTGTGTGTTGGGG - Intronic
907460169 1:54601187-54601209 GTGTGTGAGTGTGTGTGTTGGGG + Intronic
907517397 1:55001228-55001250 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
908127289 1:61043825-61043847 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
908137100 1:61144414-61144436 GTGTGTACATGTGAGTGTTGGGG + Intronic
908512526 1:64860844-64860866 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
908571445 1:65415445-65415467 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
908768927 1:67578356-67578378 GTGTGTGTGTGTGTGTGTTGAGG + Intergenic
908835956 1:68230597-68230619 GTGTGTGTGTGTGTGTGTTGAGG + Intronic
909109139 1:71452123-71452145 GAGTGTGTGTATGTGTGTTGGGG - Intronic
909318311 1:74251665-74251687 GTGTGTGCACGTGTGGGAGGAGG + Intronic
909418597 1:75435856-75435878 GTGTGTGTATGTGTGTGTGGTGG - Intronic
909507943 1:76416030-76416052 GTGTGTGTGTGTGTGTGTTGTGG - Intronic
909745583 1:79093240-79093262 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
911218241 1:95218862-95218884 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
911367138 1:96952213-96952235 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
911664511 1:100538631-100538653 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
912300027 1:108505314-108505336 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
912443798 1:109717947-109717969 GTGTGTGTGTGTGTGTGTTGGGG + Exonic
912490917 1:110062217-110062239 CAGTGTGGATGTATGTGTTGAGG - Intronic
912933499 1:113983718-113983740 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
913172882 1:116248178-116248200 GAGTGTGTATATGTGTGTGGGGG - Intergenic
913225838 1:116697390-116697412 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
913244374 1:116858938-116858960 GTGTGCGCACGTGTGTGTGTAGG - Intergenic
913260578 1:116994349-116994371 GAATGTGCATGTATATGTTGAGG + Intergenic
913270243 1:117086265-117086287 GTGTGTGCGTGTGTGTGTTAAGG + Intronic
914244554 1:145876040-145876062 GTGTGTGTTTGTGTGTGTTGGGG - Intronic
914941493 1:152027128-152027150 GAGTGTGCATGTGTTTCCTGTGG + Intergenic
915044922 1:153004248-153004270 GTGTGTGTATGTGTGTGGTGGGG - Intergenic
915609790 1:156982520-156982542 CTGTGTGCATGTGTGTGTTGGGG - Intronic
915721263 1:157987601-157987623 GAGTGGGTACGTGTGTGGGGGGG - Intergenic
915833497 1:159153577-159153599 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
916088911 1:161291810-161291832 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
916197702 1:162240267-162240289 GTGTGTGTGTGTGTGTGTTGAGG + Intronic
916322922 1:163524905-163524927 GTGTGTGTGTGTGTGTGTTGCGG + Intergenic
916693329 1:167212146-167212168 GTGTGTGTACCTGTGTGTAGAGG + Intergenic
916945493 1:169722147-169722169 GTGTGTGCGTGTGTGTGTTGGGG + Intronic
917081564 1:171261306-171261328 GTGTGTGCCTGTGTGTGTTGGGG - Intronic
917902701 1:179558955-179558977 GAATGTGTATGTGTGTGTTTAGG + Intronic
917990630 1:180374264-180374286 GAGTGTGCATGTGAGTGTAAGGG - Intronic
918358120 1:183724960-183724982 GTGTGTGTGTGTGTGTGTTGTGG - Intronic
918391659 1:184070242-184070264 GTGTTTGTATGTGTGTGTTGGGG - Intronic
918439138 1:184548210-184548232 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
918492956 1:185102248-185102270 GTGTGTGGATGTGTGTTTTGGGG + Exonic
918674570 1:187266896-187266918 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
918894366 1:190320672-190320694 GAGTGTGTGTGTGTGTGTTGGGG - Intronic
919059355 1:192611290-192611312 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
919109048 1:193193813-193193835 GTGTGTGTGTGTGTGTGTTGTGG + Intronic
919193531 1:194253920-194253942 GTGTGTGTATGTGTGTGGTGAGG - Intergenic
919780143 1:201216231-201216253 CTGGGTGCATGTGTGTGTTGGGG + Intronic
919915797 1:202138290-202138312 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
920253992 1:204641998-204642020 GTGAGTGCATGTGTGTGTTAGGG + Intronic
920349903 1:205331064-205331086 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
920612801 1:207458055-207458077 GTGTGTGTGTGTGTGTGTTGTGG - Intronic
920655609 1:207872417-207872439 GTGTGTGGATGTGTTTGTTGAGG + Intergenic
920668118 1:207981525-207981547 GTGTGTGCATGTGTGTGTAGAGG + Intergenic
920712618 1:208309639-208309661 GAGTGTGTGTGTGTATGTTGGGG + Intergenic
921070438 1:211653812-211653834 GTGTGTGTGTGTGTGTGTTGCGG - Intergenic
921335790 1:214084500-214084522 GTGTGTGTGTGTGTGTGTTGAGG - Intergenic
921644211 1:217594789-217594811 GTGTGTGCACATGTGTGTAAAGG + Intronic
921973188 1:221173470-221173492 GTGTGTGTATGTGTGTGTGGTGG + Intergenic
922127057 1:222738028-222738050 GTGTGAGTATGTGTGTGTTGGGG + Intronic
922420690 1:225459491-225459513 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
922456238 1:225775852-225775874 GTGTGTGTGTGTGTGTGTTGAGG - Intergenic
922924687 1:229338534-229338556 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
923192373 1:231631885-231631907 GTGAGTGCACGTGAGGGTTGAGG - Intronic
923377949 1:233384711-233384733 GTGTTTGCATGTGTGTGTTGGGG + Exonic
923502558 1:234578208-234578230 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
923622001 1:235587272-235587294 GTGTGTGAAGGTGTGGGTTGGGG + Intronic
923727631 1:236521237-236521259 GAGTGTGTATGAGTGTGTTTTGG + Intronic
924215744 1:241820034-241820056 GTGTGTGTGTGTGTGTGTTGAGG + Intergenic
924224891 1:241913380-241913402 GTGTGTGCAAGTGTGTGTCTAGG + Intergenic
924798203 1:247308287-247308309 ATGGGTGCACCTGTGTGTTGGGG - Intronic
1062794841 10:336904-336926 GTGTGTGTGTGTGTGTGTTGTGG + Intronic
1062794853 10:337015-337037 GTGTGTGTGTGTGTGTGTTGTGG + Intronic
1062794857 10:337056-337078 GTGTGTGTGTGTGTGTGTTGTGG + Intronic
1062794861 10:337095-337117 GTGTGTGCGTGTGTGTGTTGTGG + Intronic
1062794875 10:337204-337226 GTGTGTGCAAGTGTGTGTGGTGG + Intronic
1062794894 10:337344-337366 GTGTGCGCGCGTGTGTGTTGTGG + Intronic
1062794905 10:337440-337462 TTGTGTGTGCGTGTGTGTTGTGG + Intronic
1062794922 10:337622-337644 GTGTGTGCGCACGTGTGTTGTGG + Intronic
1062794927 10:337659-337681 GTGTGTACGCGTGTGTGTTGTGG + Intronic
1062934519 10:1375885-1375907 GTATGTGCACGTGTGTGGTGTGG - Intronic
1062960692 10:1571664-1571686 GAGTGTGCAGGTGAGTGTGCAGG + Intronic
1062960731 10:1571961-1571983 GAGTGTGCAGGTGAGTGTGCTGG + Intronic
1062960754 10:1572153-1572175 GAGTGTGCAGGTGAGTGTGCAGG + Intronic
1062988794 10:1795760-1795782 GAGTGTGCATGTTTGTGTAGGGG - Intergenic
1063033374 10:2258943-2258965 ATGTGTGCCTGTGTGTGTTGGGG - Intergenic
1063457260 10:6192695-6192717 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1063463060 10:6226502-6226524 GTCTGTGCACGTGTGTTGTGGGG + Intronic
1063541645 10:6940017-6940039 GTGTGTGCGCGTGTGTGTAAGGG - Intergenic
1063651668 10:7944119-7944141 GTGTGTGTGTGTGTGTGTTGTGG + Intronic
1063745474 10:8874978-8875000 GAGTGTGTGTGTGTGTGTTGTGG + Intergenic
1064087378 10:12355486-12355508 GCGTGTGTATGTGTGTGTGGTGG + Intronic
1064120673 10:12615438-12615460 GTGTGTGCATGTGTGTGTGTAGG + Intronic
1064283424 10:13971061-13971083 GTGTGTGCACCTGTGTGTTGGGG - Intronic
1064570038 10:16683167-16683189 GTGTGTGTGTGTGTGTGTTGTGG + Intronic
1064584466 10:16825657-16825679 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1064608089 10:17065137-17065159 GTCTGTGCATGTGTGTGTGGGGG - Intronic
1065063019 10:21927709-21927731 GTGTGTGTGCGTATGTGTTGTGG + Intronic
1065196918 10:23275574-23275596 GTGTGTGTATGTGTGTGTAGGGG - Intronic
1065286145 10:24189474-24189496 GTGTGTGCACATGTGTGTTTGGG - Intronic
1065701409 10:28429526-28429548 GTGCGTGCATGTGTGTGTGGGGG + Intergenic
1066048872 10:31617767-31617789 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1066478447 10:35771321-35771343 GCGTGTGTGTGTGTGTGTTGGGG + Intergenic
1066510543 10:36090992-36091014 GTGTGTTTAAGTGTGTGTTGAGG + Intergenic
1067061295 10:43079170-43079192 GAGTGTGCATGTGTGAGCTGTGG - Intronic
1067683006 10:48451957-48451979 GTGTGTGCAATTGTGTGTGGCGG - Intronic
1067824308 10:49558974-49558996 GTGTGTGTATGTGTGTGTTTAGG + Intergenic
1067956888 10:50801392-50801414 GGGTGTGTGTGTGTGTGTTGGGG + Exonic
1068059531 10:52050051-52050073 GTGTGTTCATGTGTGTGTGGTGG + Intronic
1068362857 10:56002212-56002234 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1068430602 10:56927188-56927210 GTGTGTGAAGCTGTGTGTTGTGG - Intergenic
1068802020 10:61152194-61152216 GAGTGTTCAGGTGTGTTTTGGGG + Intergenic
1068877044 10:62008057-62008079 GTGTGTGTGTGTGTGTGTTGTGG - Intronic
1069095463 10:64254056-64254078 GACTGTGGAGGAGTGTGTTGAGG + Intergenic
1069744245 10:70705012-70705034 GAGTGTGCGAGTGTGTGAAGGGG - Intronic
1069778916 10:70942693-70942715 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1069846359 10:71374519-71374541 GGGTGTGTGTGTGTGTGTTGTGG + Intergenic
1069863178 10:71483864-71483886 GAGAGTGAACATGTGTGTGGGGG - Intronic
1070464128 10:76702853-76702875 GAGTGAGAACCTGTGTGTTTGGG + Intergenic
1070528407 10:77314919-77314941 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1070647486 10:78211810-78211832 GTGTGTGTACGTGTGTGATGAGG + Intergenic
1070676174 10:78413146-78413168 GCGTGCACATGTGTGTGTTGGGG + Intergenic
1070772972 10:79093131-79093153 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1070805697 10:79269452-79269474 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1070809072 10:79288509-79288531 GTGTGTGCGTATGTGTGTTGGGG - Intronic
1070823608 10:79377951-79377973 GAGGGTGCACGTGTGAGATGAGG + Intergenic
1070823628 10:79378224-79378246 GAGGGTGCATGTGTGAGATGTGG + Intergenic
1070823633 10:79378262-79378284 GAGGGTGCACGTGTGCGGTGTGG + Intergenic
1071133682 10:82427083-82427105 GGGTGTGCATTTGTGTGTTTTGG + Intronic
1071290736 10:84187248-84187270 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1071513789 10:86283548-86283570 GTGTGTGCATGTGTGTGTAAGGG - Intronic
1071513865 10:86284269-86284291 GTGTGTGCAAGTGTGTGTGATGG - Intronic
1071526874 10:86364294-86364316 CTGTGTGCACGTGTGCGCTGAGG - Intronic
1071649143 10:87378717-87378739 GTGTGTGCGCGTGTGTGTGTTGG + Intergenic
1072107625 10:92289910-92289932 GTGTGTGTATGTGTGTGGTGGGG + Intronic
1072816327 10:98512808-98512830 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1073046857 10:100644496-100644518 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1073070284 10:100788895-100788917 GGGTGTGCATGTGTGTGTGTCGG - Intronic
1073131688 10:101193148-101193170 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1073153906 10:101331365-101331387 GTGTGTGTGTGTGTGTGTTGTGG + Intergenic
1073204564 10:101762075-101762097 GAGTGTGTACGAGTGTGTGAGGG - Intergenic
1073352032 10:102826846-102826868 AAGAGTGCATATGTGTGTTGGGG - Intergenic
1073488413 10:103836639-103836661 GTGTGTGCACTCGTGTGTTGGGG - Intronic
1073578561 10:104643728-104643750 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1073586966 10:104719838-104719860 GTGTGTGAATGTATGTGTTGGGG + Intronic
1073747345 10:106484332-106484354 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1074095738 10:110310734-110310756 AGGTGTGTACGTGTGTGTTTGGG + Intergenic
1074227484 10:111499936-111499958 ATGTGTGCATGTGTGTGTGGGGG + Intergenic
1074465520 10:113678626-113678648 GTGTGTGTGTGTGTGTGTTGTGG + Intergenic
1074707501 10:116148112-116148134 GTGTGTGCATGTGTGTGGGGTGG + Intronic
1074964294 10:118475246-118475268 AACGGTGCAAGTGTGTGTTGGGG - Intergenic
1075082714 10:119394599-119394621 GTGTGGGCACGTGTATGTTTGGG + Intronic
1075082738 10:119394775-119394797 GTGTGGGCACGTGTATGTTTGGG + Intronic
1075516711 10:123114646-123114668 GTGTGTGTGTGTGTGTGTTGCGG - Intergenic
1075654860 10:124154498-124154520 GAGTGTGCATGTGTGTGTGGGGG - Intergenic
1075654889 10:124154709-124154731 GAGTGTGCATGTGTGTGAGTGGG - Intergenic
1075654895 10:124154755-124154777 GAATGTGCATGTGAGTGTGGGGG - Intergenic
1075654912 10:124154908-124154930 GAGTGTGTATGTGAGTGTGGGGG - Intergenic
1075654938 10:124155074-124155096 GAGTGTGCATGCATGTGTGGGGG - Intergenic
1075791411 10:125086943-125086965 GTGGGCGCACGTGTGTGTCGTGG - Intronic
1075799583 10:125145158-125145180 GAGTGTGTGGGTGTGTGTTGGGG + Intronic
1075875063 10:125799393-125799415 GTGTGTCTATGTGTGTGTTGGGG + Intronic
1075893294 10:125972889-125972911 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1075895524 10:125991261-125991283 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1075953442 10:126502045-126502067 GTGTGTGCGTGTGTGTGGTGTGG - Intronic
1075956306 10:126526019-126526041 GTGTGTGTGTGTGTGTGTTGTGG - Intronic
1076042450 10:127262278-127262300 GTGTGTGTACCTGTGTGCTGAGG + Intronic
1076330474 10:129660771-129660793 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1076481894 10:130790160-130790182 GAGTGTGCCTGTGTGTGTGAGGG - Intergenic
1076481905 10:130790252-130790274 GAGTTTGTATGTGTGGGTTGAGG - Intergenic
1076481912 10:130790304-130790326 GAGTTTGTATGTGTGGGTTGAGG - Intergenic
1076481918 10:130790356-130790378 GAGTTTGTATGTGTGGGTTGAGG - Intergenic
1076481925 10:130790408-130790430 GAGTGTGTATGTGTGGGTTGAGG - Intergenic
1076605628 10:131687596-131687618 GAGTGTGCACCTGTGTGTGCTGG - Intergenic
1076874497 10:133209198-133209220 GCGTGTACACGTGTGTGGTTGGG + Intronic
1076903073 10:133349474-133349496 GTCTGTGCATGTGTGTTTTGTGG - Intronic
1077020514 11:415305-415327 GTGTGTGTGCGTGTGTGTTGTGG + Intronic
1077094680 11:794322-794344 GAGCGTGGACGTGTTTGTGGGGG - Intronic
1077144588 11:1039249-1039271 GTGTGTGCATGTGTGTGTATAGG + Intergenic
1077281025 11:1745821-1745843 GTGTGTGCACGGGTGTGTGAGGG - Intronic
1077305580 11:1867350-1867372 GTGTGTGCATGTGTGTGTGTGGG - Intronic
1077340402 11:2023913-2023935 GGGTGTGTGCGTGTGTGTGGTGG + Intergenic
1077721854 11:4637809-4637831 GTATGTGCACGTGTGTGTTGTGG + Intergenic
1077755088 11:5019705-5019727 GTGTGTGTGTGTGTGTGTTGAGG + Intergenic
1077772032 11:5229715-5229737 GTGTGTGTGTGTGTGTGTTGTGG - Intergenic
1077806873 11:5599307-5599329 AAGTGTGCATGTGTTTGTTGGGG + Intronic
1078120247 11:8500335-8500357 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1078738057 11:14039422-14039444 GTGTGTGTATGTGTGTGTAGGGG + Intronic
1078778022 11:14411494-14411516 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1078918586 11:15804947-15804969 GTATGTGCATGTGTGTGTTGGGG - Intergenic
1079128350 11:17734270-17734292 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1079133584 11:17763454-17763476 GAGTGTGCATGTGCGTGTCCGGG - Intronic
1079282757 11:19102614-19102636 GTGTGTGTGTGTGTGTGTTGAGG - Intergenic
1079296574 11:19240658-19240680 GCCTGTGCACGTGTGTGTAAGGG - Intronic
1079351096 11:19692811-19692833 AAGTGTGTGCATGTGTGTTGAGG + Intronic
1079732681 11:23955140-23955162 GTGTGTGTGTGTGTGTGTTGAGG + Intergenic
1079899589 11:26165389-26165411 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1080156579 11:29118465-29118487 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1080318541 11:30978775-30978797 GTGTGTGTGTGTGTGTGTTGAGG - Intronic
1080567109 11:33520680-33520702 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1080813801 11:35733801-35733823 GGATGTGCACATGTGTGTTTTGG - Intronic
1081373937 11:42337491-42337513 GTGTGTGTGTGTGTGTGTTGTGG - Intergenic
1081504985 11:43706704-43706726 GTGTGTGTGTGTGTGTGTTGTGG + Intronic
1081677262 11:44977665-44977687 GTGTGTGCATGTGTGTGATCTGG - Intergenic
1081681416 11:45008018-45008040 GTGTGTGTGTGTGTGTGTTGTGG - Intergenic
1081707259 11:45190118-45190140 GTGTGTGCACGTGTGTGTGTAGG - Intronic
1081837305 11:46166471-46166493 GTGTGTGCATGTGTGTGTGTGGG - Intergenic
1081977647 11:47245868-47245890 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1081994925 11:47357982-47358004 GTGTGAGCAGGTGTGTGTGGGGG - Intronic
1082223693 11:49674942-49674964 GTGTGTGCATGAGTGTGTTTGGG - Intergenic
1082276149 11:50223611-50223633 GTGTGTGTGTGTGTGTGTTGCGG - Intergenic
1083640696 11:64143739-64143761 GTGTGTGTATGTGTGTGTCGGGG - Intronic
1084009944 11:66342029-66342051 GTGTGTGCATGTGTGTGTGTAGG + Intronic
1084409084 11:68995914-68995936 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1084477935 11:69399388-69399410 ATGTGTGCATGTGTGTGTAGGGG + Intergenic
1084523479 11:69680849-69680871 GTGTGTGCATGTGTGTGTGTTGG - Intergenic
1084646309 11:70460663-70460685 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1084679495 11:70658204-70658226 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1085297963 11:75441552-75441574 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1085381832 11:76126926-76126948 GGCAGTGTACGTGTGTGTTGGGG - Intronic
1085448277 11:76615545-76615567 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1085507305 11:77067653-77067675 GTGTGTGTGTGTGTGTGTTGCGG + Intronic
1085683144 11:78596803-78596825 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1085761026 11:79241726-79241748 GTGTGTGCATGTGTATGGTGGGG + Intronic
1085781226 11:79410942-79410964 GTGTGTGTATGTGTGTGTAGAGG - Intronic
1085972540 11:81611120-81611142 GTGTGTGCATGTGTGTGTGTAGG + Intergenic
1085985228 11:81779028-81779050 GTGTGTGCACATGTGAGTTTTGG + Intergenic
1086375741 11:86199099-86199121 GAGAGACCATGTGTGTGTTGGGG + Intergenic
1086625361 11:88944320-88944342 GTGTGTGCATGAGTGTGTTTGGG + Intronic
1086905404 11:92412849-92412871 GGCTGTGCATGTGTGTGTAGGGG - Intronic
1087183397 11:95160834-95160856 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1087484091 11:98739260-98739282 GTGTGTGCATGTGTATATTGGGG + Intergenic
1087579595 11:100035203-100035225 GAGTGAGAACATGTGTGTTTGGG + Intronic
1087781456 11:102305124-102305146 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1087968938 11:104455005-104455027 GAGTGTTTATGTGTGTGGTGGGG + Intergenic
1088021111 11:105120672-105120694 GTGTGTGTATGTGTGTGTTGGGG - Intergenic
1088234283 11:107705826-107705848 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1088543632 11:110938292-110938314 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1088901257 11:114119378-114119400 GTGTGTGCACATGTGTGTACAGG + Intronic
1089138460 11:116267987-116268009 GAGTGGGCAGGGGTGTGGTGTGG - Intergenic
1089281940 11:117380877-117380899 GTGTGTGCACGTGTGTGTACTGG + Intronic
1089398477 11:118151107-118151129 GTGTGTGCACGTGTGTAAGGGGG - Intronic
1089481078 11:118805686-118805708 TAGTGTGTATGTGTGTGTTGGGG + Intergenic
1090081168 11:123613721-123613743 GAGTGTGCATGTGTGTGCCTTGG - Intronic
1090399196 11:126437982-126438004 GATTGTGTACATGTGTGGTGTGG - Intronic
1090401341 11:126450371-126450393 GAGTGTGCATGTGTGAGTGTGGG + Intronic
1090428828 11:126629233-126629255 GACTGTGCACATGTGGGTAGAGG + Intronic
1091129885 11:133136859-133136881 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1091150741 11:133326334-133326356 GTGTGTGTATGTGTGTGTGGGGG + Intronic
1091215943 11:133901963-133901985 TGGTGTGCATGTGTGTGATGCGG - Intergenic
1091271493 11:134314774-134314796 AATTGTGTACGTGTGTGTTCAGG - Intronic
1202823387 11_KI270721v1_random:79102-79124 GGGTGTGTGCGTGTGTGTGGTGG + Intergenic
1091516720 12:1191292-1191314 ATGTGTACATGTGTGTGTTGTGG - Intronic
1091535360 12:1402610-1402632 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1091592538 12:1853505-1853527 GTGTGTGCCCATGAGTGTTGGGG - Intronic
1091616883 12:2056221-2056243 GTGTGTGTGTGTGTGTGTTGAGG + Intronic
1091713775 12:2761535-2761557 GTGTGTGCATGTGTGTGTTGGGG - Intergenic
1091845680 12:3654551-3654573 GAGTGTGTACGTGTGAACTGAGG - Intronic
1092049135 12:5455529-5455551 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1092120117 12:6037886-6037908 ATGTGAGCATGTGTGTGTTGGGG + Intronic
1092204717 12:6607667-6607689 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1092262291 12:6959208-6959230 GTGTGTGAATGTGTGTGTGGCGG - Intronic
1092312563 12:7374394-7374416 GTGTGTGCACGTGTGTGTAGAGG + Intronic
1092482070 12:8868458-8868480 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1092536778 12:9396110-9396132 GTGTGTGGATGTGTGTGTTAAGG + Intergenic
1092557898 12:9577197-9577219 GTGTGTGGATGTGTGTGTTAAGG - Intergenic
1092937076 12:13374092-13374114 GTGTGTGCATGTGTGTGTTGGGG + Intronic
1093112997 12:15175371-15175393 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1093159694 12:15731851-15731873 GTGTGTGCATGTGTGTGTGTAGG + Intronic
1093379492 12:18475369-18475391 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1093787292 12:23207360-23207382 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1093788419 12:23218525-23218547 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1093842319 12:23919110-23919132 CATTGTGCATGTGTGTGTTTGGG + Intronic
1094005005 12:25740046-25740068 GTGTGTGCGAGTGTGTGGTGAGG - Intergenic
1094123864 12:27002041-27002063 ACGTGTGTGCGTGTGTGTTGTGG - Intronic
1094136673 12:27134670-27134692 GAGTGTGCACATCTTTTTTGCGG - Intergenic
1094211639 12:27899580-27899602 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1094218808 12:27971788-27971810 GTGTGTGCGTGTGTGTGTTTTGG - Intronic
1094282109 12:28751796-28751818 GTGTGTGTGTGTGTGTGTTGTGG - Intergenic
1094479153 12:30866845-30866867 GTGTGTGCACATGTGTGATTTGG - Intergenic
1094513396 12:31110728-31110750 GTGTGTGGATGTGTGTGTTAAGG + Intergenic
1095211813 12:39503069-39503091 GTGTGTGTATGTGTGTGGTGGGG - Intergenic
1095246613 12:39930452-39930474 GAATGTGAATGTGTGTATTGTGG + Intronic
1095438640 12:42219619-42219641 GTGTGTGCATGTGTGTGTGCAGG - Intronic
1095481552 12:42641398-42641420 GGCTGTGCATGTGTGTGCTGGGG - Intergenic
1095909041 12:47407045-47407067 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1096451589 12:51747115-51747137 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1096558096 12:52416272-52416294 GTGTATGCATGTGTGTGTGGGGG + Intergenic
1096793358 12:54058973-54058995 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1096878144 12:54646260-54646282 GAGGGTGCAGGTGTGTGCTGTGG + Intronic
1097053733 12:56238307-56238329 CTGTGTGCAGGTGTGTGTTGGGG - Exonic
1097555188 12:61127785-61127807 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1097636077 12:62123720-62123742 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1097636085 12:62123767-62123789 GTGTGTGTATGTGTGTGGTGGGG - Intronic
1097702694 12:62836625-62836647 GATTGTGTGTGTGTGTGTTGGGG + Intronic
1097931644 12:65193758-65193780 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1098359152 12:69638348-69638370 GTGTGTGTGTGTGTGTGTTGAGG + Intergenic
1098761413 12:74429923-74429945 GTGTGTGTGTGTGTGTGTTGAGG - Intergenic
1098770153 12:74541138-74541160 GTGTGTGTATGTGTGTGTTATGG + Exonic
1098981561 12:76962129-76962151 GTGTGTGTGTGTGTGTGTTGTGG - Intergenic
1099301945 12:80907081-80907103 GTGTGTGTGTGTGTGTGTTGAGG + Intronic
1099767613 12:87008570-87008592 GTGTGTGTGTGTGTGTGTTGTGG + Intergenic
1099884315 12:88508567-88508589 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1099941612 12:89195647-89195669 GTGTGTGTGTGTGTGTGTTGTGG - Intergenic
1100370647 12:93966155-93966177 CAGAGTACACATGTGTGTTGGGG - Intergenic
1100418622 12:94406475-94406497 GAGTGTGTGTGTGTGTGGTGGGG + Intronic
1101576608 12:106002855-106002877 GTGTGTGTATGTGTGTGATGAGG - Intergenic
1101717273 12:107321472-107321494 GTGTGTGTTTGTGTGTGTTGGGG + Intronic
1101726387 12:107391845-107391867 GCGTGTGTATGTGTGTGATGGGG + Intronic
1101759966 12:107650415-107650437 GTGTGTCCATGTGTGTGTTTGGG - Intronic
1102044079 12:109818795-109818817 GTGTGTGCATGTGTGTTTTGGGG - Intronic
1102420950 12:112802632-112802654 GAGTGCACATGTGTGTGTTCAGG + Intronic
1102422365 12:112814078-112814100 GAGTGTGCACGAGTGTGTAGGGG + Intronic
1102430981 12:112882580-112882602 AAGTATACGCGTGTGTGTTGAGG - Intronic
1102695847 12:114798799-114798821 GTGTGTGCACGTGTGTGTAAGGG + Intergenic
1102717986 12:114990708-114990730 GGGTGTTTGCGTGTGTGTTGTGG + Intergenic
1102902031 12:116646422-116646444 GTGTGTGCACGTGTATGTGTGGG - Intergenic
1103055371 12:117816023-117816045 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1103165782 12:118769315-118769337 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1103210044 12:119159001-119159023 GTGTGTGTGTGTGTGTGTTGGGG + Exonic
1103310937 12:120007450-120007472 GAGTGTGTACGTGGGGGGTGGGG - Intronic
1103360786 12:120352375-120352397 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1103452834 12:121041540-121041562 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1103539956 12:121659120-121659142 GTGTGCGCGCGTGTGTGTTTAGG - Intronic
1103615500 12:122149187-122149209 GTGCGTGCACCTGTGTGGTGGGG - Intergenic
1104086083 12:125475154-125475176 AAGTGTGTGTGTGTGTGTTGGGG + Intronic
1104112288 12:125715412-125715434 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1104259444 12:127169461-127169483 TAGTGTGCACGTGTTTGTGCAGG - Intergenic
1104478042 12:129086214-129086236 GTGTGTGTGTGTGTGTGTTGTGG + Intronic
1104557883 12:129818415-129818437 AAGTGTGTATGTGTGTGGTGGGG + Intronic
1104620429 12:130307873-130307895 GGGTGTGGACGTGACTGTTGAGG + Intergenic
1104759893 12:131290804-131290826 GTGTGTGCAGGTGTGTGTGCAGG - Intergenic
1104759894 12:131290816-131290838 GTGTGTGCAGGTGTGTGTGCAGG - Intergenic
1104759895 12:131290828-131290850 GTGTGTGCAGGTGTGTGTGCAGG - Intergenic
1104820829 12:131676332-131676354 GTGTGTGCAGGTGTGTGTGCAGG + Intergenic
1104820830 12:131676344-131676366 GTGTGTGCAGGTGTGTGTGCAGG + Intergenic
1104820832 12:131676366-131676388 GTGTGTGCAGGTGTGTGTGCAGG + Intergenic
1104929610 12:132331265-132331287 GTGTATGCACATGTGTGTAGGGG + Intergenic
1104944942 12:132411378-132411400 GTGTGTGCATGTGTGTGTGTGGG - Intergenic
1104944969 12:132411589-132411611 GTGTGTGCATGTGTGTGTGTGGG - Intergenic
1105024613 12:132839715-132839737 GAGTTTGCACGTTTGTGCAGGGG - Intronic
1105577805 13:21669894-21669916 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1105882176 13:24614670-24614692 GGGAGTGCAGGTGTGTGTCGGGG - Intergenic
1105937456 13:25115414-25115436 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1105937461 13:25115466-25115488 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1105937466 13:25115508-25115530 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1105969910 13:25419083-25419105 GTGTGTGCACGCACGTGTTGAGG + Intronic
1106059054 13:26268252-26268274 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1106132300 13:26950658-26950680 GTGTGTGCGTGTGTGTGCTGTGG - Intergenic
1106136195 13:26975588-26975610 GTGTGTGTAGGTGTGTGTGGGGG - Intergenic
1106219984 13:27738287-27738309 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1106305658 13:28506876-28506898 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1106333601 13:28763052-28763074 GCATGTGCACGTGTGTGTAGGGG + Intergenic
1106486070 13:30173881-30173903 GTGTGTGCACATGTGTGTGGGGG - Intergenic
1106546943 13:30738929-30738951 GAGTGTGTGTGTGTGTGTTGGGG - Intronic
1106756023 13:32823890-32823912 GAGTGTATATGTGTGTGTTGGGG + Intergenic
1106803733 13:33284641-33284663 GACTGTAAACGTGTGTGTTAGGG + Intronic
1106841561 13:33690178-33690200 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1106915311 13:34507433-34507455 GAGGCTGGAGGTGTGTGTTGGGG - Intergenic
1107030821 13:35852009-35852031 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1107235460 13:38163578-38163600 GTGTGTGTGCGTGTGTGTTTTGG + Intergenic
1107279455 13:38716825-38716847 GCCTGTGCACATGTGTGTTTTGG - Intronic
1107731252 13:43351276-43351298 GAGATTGCATGTGTGTTTTGGGG - Intronic
1107842032 13:44467987-44468009 GTGTGTGCGCGTGTGTGTATAGG - Intronic
1107846077 13:44514497-44514519 GTGTGTGTATGTGTGTGTTTTGG - Intronic
1108065698 13:46575528-46575550 GTGTGTGTGTGTGTGTGTTGTGG + Intronic
1108244269 13:48499107-48499129 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1108363707 13:49690487-49690509 GTGCGTGCGCGTGTGTGGTGGGG + Intronic
1108518145 13:51222046-51222068 GCGTGACCGCGTGTGTGTTGTGG - Intergenic
1108537457 13:51399724-51399746 GTGTGTGTGCGTGTGTGTAGTGG + Intronic
1108626351 13:52232578-52232600 GTGTGTGTGTGTGTGTGTTGTGG - Intergenic
1108646628 13:52436214-52436236 GTGTGTGTGTGTGTGTGTTGTGG - Intronic
1108739148 13:53317278-53317300 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1109417171 13:62055928-62055950 GTGTGTGTATGTGTGTGTGGTGG - Intergenic
1109539339 13:63752270-63752292 GTGTGTGTGTGTGTGTGTTGAGG + Intergenic
1109544505 13:63827564-63827586 GTGTGTGTGTGTGTGTGTTGAGG - Intergenic
1110286145 13:73752413-73752435 CAGGGTGCATGTGTGTGGTGTGG - Intronic
1110408615 13:75179109-75179131 GTGTGTGCATGTGTGTGTGTGGG + Intergenic
1110640629 13:77819865-77819887 GAGTGTGTATGTGTCAGTTGAGG + Intergenic
1110671241 13:78181355-78181377 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1110798683 13:79669994-79670016 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1111076244 13:83239806-83239828 GTGTGCGCATGTGTGTGTGGTGG - Intergenic
1111531773 13:89545879-89545901 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1111641416 13:90975377-90975399 GAGTTTGCAGGGGTGTGTGGAGG - Intergenic
1111656964 13:91166002-91166024 GACTGTGCGTGTGTGTGTTGGGG + Intergenic
1111768005 13:92559352-92559374 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1112163992 13:96898118-96898140 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1112439329 13:99414440-99414462 GTGTGTGCACGTGTGTGAGTGGG - Intergenic
1112562141 13:100524395-100524417 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1112565701 13:100549825-100549847 GTATGTGCTCATGTGTGTTGGGG - Intronic
1112944828 13:104915370-104915392 GTGTGTGCATGTGTGTGTGCAGG - Intergenic
1113020638 13:105882375-105882397 GTGTGTGTGTGTGTGTGTTGAGG - Intergenic
1113036914 13:106060880-106060902 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1113097867 13:106685174-106685196 GTGTGTACACATGTGTGTTTAGG - Intergenic
1113598931 13:111554654-111554676 GGGTGTGAACGTGTGTGGGGAGG - Intergenic
1113667888 13:112153600-112153622 GAGAGTGCGGGTGTGTGCTGTGG + Intergenic
1113697695 13:112358310-112358332 GAATGTGCATGTGTGTTGTGGGG + Intergenic
1113870563 13:113557184-113557206 GTGTGTGCACATGTGTGTAGGGG + Intergenic
1113901399 13:113800325-113800347 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1113963943 13:114141306-114141328 GTGTGTGCATGTGTGTGTGAGGG - Intergenic
1114626699 14:24135101-24135123 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1114927231 14:27419307-27419329 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1115056120 14:29129272-29129294 GTGTGTGTATGTGTGTGTAGGGG - Intergenic
1115125425 14:29987318-29987340 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1115369203 14:32593007-32593029 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1115413290 14:33101134-33101156 GTGTGTGCAGGTGTGTGTGGGGG - Intronic
1115497859 14:34024866-34024888 GAGTGTGGGTGTGTGTGTTGGGG - Intronic
1115841895 14:37481556-37481578 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1115901631 14:38157613-38157635 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1116373230 14:44162770-44162792 GTGTGTGTGTGTGTGTGTTGTGG + Intergenic
1116530354 14:45965255-45965277 GTGTGTGCGCGTGTGTGTGCTGG + Intergenic
1116730993 14:48622460-48622482 GAGTGTGTTCGTGTGTGTGTTGG - Intergenic
1116776669 14:49189191-49189213 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1117571602 14:57054494-57054516 GATGGTGCATGTGTGTGTTTGGG + Intergenic
1117734978 14:58759659-58759681 GAGTGTGCAGATGTCTCTTGTGG + Intergenic
1117903437 14:60559797-60559819 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1118043044 14:61938022-61938044 GTGTGTGTGTGTGTGTGTTGCGG - Intergenic
1118106455 14:62665650-62665672 GGGTGTGTGTGTGTGTGTTGCGG - Intergenic
1118179965 14:63482841-63482863 GAATGTGTACTTGTATGTTGAGG - Intronic
1118181035 14:63493486-63493508 GTGTGTGTGCGTGTGTGTGGTGG + Intronic
1118181037 14:63493488-63493510 GTGTGTGCGTGTGTGTGGTGGGG + Intronic
1118509319 14:66453634-66453656 GTGTGTGCATGTGTATATTGAGG + Intergenic
1118882773 14:69843041-69843063 GAGTGTGCAGGTGTGAGTGCTGG + Intergenic
1118917048 14:70116359-70116381 GTGTGTGCACGTTTGTGTGCAGG + Intronic
1119144812 14:72302661-72302683 GTATGTGTATGTGTGTGTTGGGG - Intronic
1119262801 14:73247664-73247686 GTGTGTGTGTGTGTGTGTTGTGG + Intronic
1119262836 14:73247918-73247940 GTGTGTGTGTGTGTGTGTTGTGG + Intronic
1119262860 14:73248103-73248125 GTGTGCGCGTGTGTGTGTTGTGG + Intronic
1119262872 14:73248181-73248203 GTGTGTGTCTGTGTGTGTTGTGG + Intronic
1119262884 14:73248257-73248279 GTGTGTGTGTGTGTGTGTTGTGG + Intronic
1119282378 14:73420463-73420485 GTGTGTGCATGTGTGTGTATAGG + Intronic
1119717062 14:76866958-76866980 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1119717144 14:76867230-76867252 GTGTGTGGGGGTGTGTGTTGGGG + Intronic
1119733498 14:76966095-76966117 GAGTAGGAAGGTGTGTGTTGGGG + Intergenic
1119756339 14:77122633-77122655 TAGTGTGCTTGGGTGTGTTGGGG - Intronic
1119871971 14:78025821-78025843 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1119889811 14:78174295-78174317 GAGTGTACACATGTGTATGGGGG - Intergenic
1120015706 14:79470980-79471002 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1120476059 14:84988833-84988855 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1120653819 14:87165780-87165802 GTGTGTGTATGTGTGTGTTGGGG - Intergenic
1120753781 14:88222626-88222648 GAGACTGCACATGTGTGTAGGGG + Intronic
1121374605 14:93396791-93396813 GTGTGTGTGTGTGTGTGTTGTGG + Intronic
1121660751 14:95633242-95633264 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1121843389 14:97153011-97153033 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1121843678 14:97155240-97155262 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1121860861 14:97316750-97316772 GTGTGTGTGTGTGTGTGTTGAGG + Intergenic
1122120596 14:99551551-99551573 GAGTGTGCAGGTGGGTGTGCAGG + Intronic
1122153926 14:99739138-99739160 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1122209912 14:100167311-100167333 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1122283075 14:100635757-100635779 GTGTGTGTGTGTGTGTGTTGTGG - Intergenic
1122368333 14:101212351-101212373 GTGTGTGTGCGTGTGTGTTGAGG - Intergenic
1122828623 14:104384356-104384378 GAATGTGCACATGTGTGAAGGGG + Intergenic
1122979773 14:105186275-105186297 GTGTGTGGAGGTGTGTGTGGGGG + Intergenic
1123054746 14:105563989-105564011 GTGTGTGCACGTGTGGGGTGTGG + Intergenic
1123079186 14:105683548-105683570 GTGTGTGCACGTGTGGGGTGTGG + Intergenic
1123175663 14:106416416-106416438 GTGTGTGTGTGTGTGTGTTGTGG - Intergenic
1123207235 14:106725324-106725346 GTGTGTGCGTGTGTGTGTGGGGG - Intergenic
1123212256 14:106772318-106772340 GTGTGTGCGTGTGTGTGTGGGGG - Intergenic
1123660214 15:22558062-22558084 GAGTGAGCACGTGTGAGTGTGGG + Intergenic
1124250710 15:28104953-28104975 GTGTGTGTACATGTGTGTGGTGG + Intergenic
1124250881 15:28105956-28105978 GTGTGTGCATGTGTGGGGTGTGG + Intergenic
1124377626 15:29138709-29138731 GTGTGTGTGTGTGTGTGTTGAGG + Intronic
1124437678 15:29664599-29664621 CAGTGGGCGCGTTTGTGTTGGGG - Intergenic
1124631686 15:31341350-31341372 GTGTGTGTACGTGTGTGTGTCGG + Intronic
1124646989 15:31444269-31444291 GTGTGTGTAGGTGTGTGTCGGGG + Intergenic
1124827742 15:33115499-33115521 GTGTGTGCGTGTGTGTGTGGGGG - Intronic
1124869277 15:33524115-33524137 GTGTGTGTATGTGTGTGTAGGGG - Intronic
1125547800 15:40520007-40520029 GGGGGTGCCCATGTGTGTTGGGG - Intergenic
1125556087 15:40586249-40586271 GGGTGTGCTGGTGTGTGCTGCGG - Intergenic
1126282405 15:46970027-46970049 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1126296178 15:47137749-47137771 GTGTGTGTATTTGTGTGTTGTGG + Intergenic
1126408332 15:48345906-48345928 GGCTGTGCACGTGTGTGAGGAGG - Intergenic
1126434636 15:48623920-48623942 GAGAGAGAATGTGTGTGTTGGGG - Intronic
1127122499 15:55783877-55783899 GTGTGTGTGTGTGTGTGTTGAGG - Intergenic
1127340131 15:58032785-58032807 GTGTGTGTGTGTGTGTGTTGAGG - Intronic
1127526399 15:59796438-59796460 GTGTGTGCATGTGTGTGTTGGGG - Intergenic
1127629102 15:60809619-60809641 AAATGTGCATGTGTGTGGTGGGG - Intronic
1127848779 15:62895255-62895277 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1128078474 15:64842442-64842464 GTGTGTGTATGTGTGTGTTGGGG + Intronic
1128078483 15:64842501-64842523 GTGTGTGTATGTGTGTGTTGGGG + Intronic
1128650517 15:69409219-69409241 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1128896450 15:71377863-71377885 GTGTGTGTGTGTGTGTGTTGTGG - Intronic
1129086478 15:73098078-73098100 GTGTGTGTGTGTGTGTGTTGTGG - Intronic
1129170582 15:73805099-73805121 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1130185356 15:81675777-81675799 GTGTGTGTATGTGTGTGTGGGGG - Intergenic
1130186049 15:81683521-81683543 GAGTGTGTGTGTGTGTGTGGGGG - Intergenic
1130447703 15:84019062-84019084 GTGTGTGTATGTGTGTGTGGTGG - Intronic
1130757436 15:86779916-86779938 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1130852102 15:87804817-87804839 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1130861217 15:87892079-87892101 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1130879026 15:88039114-88039136 GTGTGTGTGTGTGTGTGTTGAGG - Intronic
1131053104 15:89360808-89360830 ATGTGTGCGTGTGTGTGTTGTGG - Intergenic
1131476709 15:92746188-92746210 GAGAGTGACTGTGTGTGTTGAGG - Intronic
1131509991 15:93044568-93044590 GAGTGTGTGCGTGCGTGTGGCGG + Intronic
1131587814 15:93715395-93715417 GTGTGTGTGTGTGTGTGTTGTGG + Intergenic
1131619459 15:94052156-94052178 GTGAGTGCATGTGTGTGTGGGGG - Intergenic
1132100859 15:99021968-99021990 GTGTGTGTATGTGTGTGTGGAGG + Intergenic
1132507755 16:320552-320574 AAATTTGCACGTGTGTGTTAAGG - Intronic
1132632483 16:926496-926518 GTGTTTGCACGTCTGTGTTTGGG + Intronic
1133222196 16:4323562-4323584 GAGTGTGCGTGTGTGTGCCGGGG + Intronic
1133619994 16:7517171-7517193 GTGTGTGTGTGTGTGTGTTGTGG + Intronic
1133743913 16:8673422-8673444 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1133925910 16:10192340-10192362 GGGTGTGCTCGTGTGTGTCTGGG + Intergenic
1134115418 16:11544186-11544208 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1134389832 16:13809090-13809112 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1135031935 16:19045468-19045490 GTGTGTGCATGTGTGTGGTGGGG - Intronic
1135111410 16:19693267-19693289 GTATGTGGATGTGTGTGTTGCGG + Intronic
1135128602 16:19833091-19833113 GTGTGTGTATGTGTGTGGTGAGG + Intronic
1135486107 16:22866390-22866412 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1135549803 16:23389338-23389360 GAGTGTGTATGTGTGTGGTTGGG - Intronic
1135993616 16:27232212-27232234 GCTTGTGCCCATGTGTGTTGAGG - Intronic
1136282074 16:29219545-29219567 GAGTGTGCAAATGTGTGTGTGGG - Intergenic
1136605723 16:31332015-31332037 GTGTGTGCATGTGTGTGCTCAGG + Exonic
1136606267 16:31336156-31336178 GAGTGTGGTCGTGTGAGTTCTGG + Intergenic
1136653485 16:31693741-31693763 GTGTGTGCATGTGTGTGCTGTGG - Intergenic
1136690410 16:32024496-32024518 GTGTGTGCACGTATGTGTGCTGG - Intergenic
1136790999 16:32968060-32968082 GTGTGTGCACGTATGTGTGCTGG - Intergenic
1136878814 16:33885872-33885894 GTGTGTGCACGTATGTGTGCTGG + Intergenic
1137788144 16:51153431-51153453 GGGTGTGAATGTGTGTGTTAGGG - Intergenic
1137788570 16:51155519-51155541 GTGTGTGCATGTGTGTGTGTTGG + Intergenic
1137793570 16:51195914-51195936 GTGTGTGCATGTGTGTGTGTTGG - Intergenic
1138116163 16:54362373-54362395 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1138340534 16:56286189-56286211 GTGTGTGCAGATGTGTGTAGCGG - Intronic
1138496988 16:57415025-57415047 GAGTGTCTGCGTGTGTGTTGCGG - Intronic
1138522376 16:57578224-57578246 GTGTGTGCATGTGTGTGTATGGG + Intronic
1138522948 16:57582121-57582143 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1138927576 16:61611163-61611185 GTGTATGCATGTGTGTTTTGGGG - Intergenic
1138931520 16:61663872-61663894 GTGTGTGTATGTGTGTCTTGAGG + Intronic
1138937468 16:61746552-61746574 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1139037260 16:62962448-62962470 GTGTGTGTATGTGTGTGTGGAGG + Intergenic
1139401880 16:66688523-66688545 GTGTGTGTGTGTGTGTGTTGAGG - Intronic
1139831203 16:69799720-69799742 ATGTGTGCACGTGTGTGTCTGGG + Intronic
1140245861 16:73248665-73248687 GCACGTGCACGTGTGTGTTGTGG + Intergenic
1140331600 16:74062816-74062838 GTGTGTGCTTGTGTGTGTTAAGG + Intergenic
1140477916 16:75248261-75248283 GCGGGTGCATGTGTGCGTTGGGG - Intronic
1140513581 16:75526223-75526245 GAGTGTGCATGTGTGTGTGTGGG + Intergenic
1140529883 16:75655976-75655998 GTGTGTGCACGTGTGTGTGAGGG - Intronic
1140888722 16:79267418-79267440 GTGTGTGTACGTGTGTGGTATGG + Intergenic
1141126531 16:81404556-81404578 CAGGGTGTACGTGTGTGTTGGGG - Intergenic
1141441623 16:84033032-84033054 GTGTGGGTAGGTGTGTGTTGTGG + Intronic
1141481543 16:84309837-84309859 GTGTGTACATGTGTGTGTGGGGG + Intronic
1141492504 16:84383743-84383765 GTGTGTGTATGTGTGTGTTGGGG + Intronic
1141622767 16:85245883-85245905 GTGTGTGTGCGTGTGTGTCGAGG + Intergenic
1141681527 16:85547019-85547041 GAGTGTGGACGTGAGTTTTGTGG + Intergenic
1141787101 16:86208871-86208893 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1141928981 16:87188206-87188228 ATGTGTGCACGTGTGAGTAGGGG + Intronic
1141983420 16:87563866-87563888 GTGTGTGCGCGTGTGTGTTGGGG + Intergenic
1141983423 16:87563912-87563934 GTGTGTTCATGTGTGTGCTGGGG + Intergenic
1141983426 16:87563952-87563974 TTGTGTGTGCGTGTGTGTTGGGG + Intergenic
1141983429 16:87563992-87564014 GTGTGTGTGCGCGTGTGTTGGGG + Intergenic
1141983453 16:87564284-87564306 GTGTGTGCGCATGGGTGTTGGGG + Intergenic
1141983456 16:87564334-87564356 GTGTGTGTGCGTGTGTGTTGGGG + Intergenic
1141983466 16:87564475-87564497 ATGTGTGTGCGTGTGTGTTGGGG + Intergenic
1141983690 16:87565849-87565871 GTGTGTGCGTGTGTGTGTAGGGG + Intergenic
1142003798 16:87679669-87679691 GTGTGTGCACGTGTGGGTCTGGG + Intronic
1142034019 16:87852670-87852692 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1142296525 16:89226765-89226787 GAGTTCTCACGTGTGTGCTGAGG - Exonic
1142410629 16:89914484-89914506 GTGTGTGCGCCTGTGTGTGGGGG + Intronic
1203093206 16_KI270728v1_random:1229517-1229539 GTGTGTGCACGTATGTGTGCTGG - Intergenic
1142477421 17:197693-197715 GTGTGTACATGTGTGTGTAGTGG + Intergenic
1142518392 17:488993-489015 GTGTGTGTTTGTGTGTGTTGGGG + Intergenic
1142518397 17:489031-489053 GTGTGTGTTTGTGTGTGTTGGGG + Intergenic
1142561604 17:812573-812595 GTGTGTGCACGTGTGTGTGATGG + Intronic
1142561617 17:812822-812844 GAGTGTGCATGTGTGAGTGTAGG + Intronic
1142562020 17:815855-815877 GTGTGTGCACGTGTGTGCACAGG - Intronic
1142627600 17:1202490-1202512 GAGTGGGCACGTGTGTGTTTGGG - Intronic
1142639170 17:1275696-1275718 GTGTGTGAATGTGTGTGTGGGGG + Intergenic
1142754391 17:2007333-2007355 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1142803736 17:2360947-2360969 GAGTGTGTATGTGTGTGGGGCGG - Intronic
1143015421 17:3888918-3888940 GTGTGTGTGTGTGTGTGTTGTGG + Intronic
1143019068 17:3907311-3907333 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1143167404 17:4903789-4903811 ATGTGTGCACGTGTGTGTTTAGG - Intergenic
1143476015 17:7204404-7204426 GCGTGTGCGTGTGTGTGATGTGG - Intronic
1143564618 17:7714149-7714171 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1143590537 17:7884067-7884089 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1144757938 17:17691587-17691609 GAAAGTGCAGGAGTGTGTTGTGG + Intronic
1144873723 17:18385606-18385628 GTGTGTGTGCATGTGTGTTGTGG + Intronic
1145158742 17:20560175-20560197 GTGTGTGTGCATGTGTGTTGTGG - Intergenic
1145411415 17:22669296-22669318 GAGTGTGTGTGTGTGTGTGGGGG + Intergenic
1145770733 17:27491335-27491357 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1146613275 17:34327733-34327755 GTGTGTGTGCGTGTGTGTGGGGG + Intergenic
1146624196 17:34423642-34423664 ACGTGTGCATGTGTCTGTTGTGG + Intergenic
1146665281 17:34698128-34698150 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1146669939 17:34730241-34730263 GTGTGTGCATGTGTGTGTGCGGG - Intergenic
1146795120 17:35775132-35775154 GTATGTGCATGTGTGTGTTTGGG + Intronic
1146828507 17:36046047-36046069 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1146908955 17:36635685-36635707 GTGTGTGTAAGTGTGTGTTGGGG - Intergenic
1146967677 17:37046726-37046748 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1147163372 17:38580273-38580295 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1147307933 17:39576500-39576522 GTGTGTCAATGTGTGTGTTGAGG + Intergenic
1147317136 17:39626475-39626497 GAGTGTGCAGGGGTGTGCCGGGG - Intergenic
1147341543 17:39755559-39755581 GTGTGTGTTTGTGTGTGTTGAGG - Intergenic
1147382032 17:40061970-40061992 GTGTGTGTATGTGTGTGCTGGGG + Intronic
1147395604 17:40140313-40140335 GTGTGTGTGTGTGTGTGTTGGGG - Exonic
1147395607 17:40140349-40140371 GGGTGTGTGTGTGTGTGTTGGGG - Exonic
1147395610 17:40140369-40140391 GTGTGTGTGTGTGTGTGTTGGGG - Exonic
1147568581 17:41552793-41552815 GTGTGTGTTTGTGTGTGTTGGGG - Intergenic
1147627510 17:41909610-41909632 GGGTGTGGACGTGGGTGATGTGG - Exonic
1147686136 17:42287988-42288010 GTGTGCGCATGTGTGTCTTGGGG - Intronic
1147747670 17:42705244-42705266 GGATGTGCACATGTGTGGTGGGG + Intronic
1147779585 17:42930940-42930962 GTGTGTGTATGTGTGTTTTGGGG - Intergenic
1147875783 17:43619429-43619451 GTGTGTGCATGTGTGTATGGAGG - Intergenic
1147995434 17:44357741-44357763 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1148104337 17:45111386-45111408 GTGTGTGTGTGTGTGTGTTGTGG + Exonic
1148142250 17:45337244-45337266 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1148210154 17:45803790-45803812 GTGTGTGCATGTGTGTGTGTTGG + Intronic
1148228352 17:45915262-45915284 GAGTGTGTATGTGTGTGGTGTGG + Intronic
1148330173 17:46809469-46809491 GTGTGTGTACGTGTGTGTTGGGG - Intronic
1148478394 17:47944219-47944241 GTGTGTGTGTGTGTGTGTTGTGG + Intronic
1148485578 17:47988678-47988700 GTGTGTGTATGTGTGTGTGGGGG - Intergenic
1148550256 17:48545987-48546009 GTGTGTGCATGAGTGTGGTGGGG + Intergenic
1148647736 17:49228959-49228981 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1148754120 17:49963611-49963633 GTGTGTGTGTGTGTGTGTTGTGG + Intergenic
1148784453 17:50139212-50139234 GTGCGTGCATGTGTGTGTTGAGG - Intronic
1148789829 17:50166912-50166934 GTGTGTGAAGGTGTGTGTGGGGG - Intronic
1149051895 17:52314887-52314909 GAGTGTGTATGTGTGTGTTGAGG - Intergenic
1149117985 17:53122190-53122212 GTGTGTGTATGTGTGTGTAGAGG + Intergenic
1149593844 17:57851670-57851692 GTGTGTGTGTGTGTGTGTTGTGG - Intergenic
1149614583 17:57987823-57987845 GTGTGTGCGTGTGTGTGCTGGGG + Intronic
1149620340 17:58040071-58040093 GAGTGTGTATGTATGTGATGGGG + Intergenic
1150439488 17:65179665-65179687 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1151227005 17:72655212-72655234 GCGTGTGCACGGGTGTGTGGAGG - Intronic
1151267979 17:72971303-72971325 GTGTGTGTATGTGTGTGTGGAGG - Intronic
1151506406 17:74530546-74530568 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1151593518 17:75062695-75062717 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1151888653 17:76939058-76939080 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1151930089 17:77226896-77226918 GTGTGTGTATGTGTGTGTTTGGG + Intergenic
1152089428 17:78238616-78238638 GCATGTGCATGTGTGTGCTGGGG + Intronic
1152191879 17:78893071-78893093 GTGTGTGCACGCGTGTGCAGGGG + Intronic
1152191894 17:78893203-78893225 GTGTGTGCATGTGTGTGCAGGGG + Intronic
1152245726 17:79183717-79183739 GCGTGTGCGCGCGTGTGTAGCGG + Intronic
1152282230 17:79391726-79391748 CTGTGTGCACGTGTGAGTTAGGG + Intronic
1152330668 17:79670771-79670793 GCGTGCGCACGTGTGTCTTCTGG - Intergenic
1152521593 17:80859710-80859732 CTGTGTGCACGTGTGTGCGGGGG + Intronic
1152582009 17:81169978-81170000 GTGTGTGCATGTGTGTGTGTTGG + Intergenic
1152662056 17:81547082-81547104 GAGGGGGCCCGTGTGTGTGGCGG + Exonic
1152733417 17:81984828-81984850 GTGTGTGCAGGGGTGTGTGGGGG - Intronic
1152733457 17:81984995-81985017 GTGTGTGCAGGTGTGTGGGGGGG - Intronic
1152737852 17:82006077-82006099 GCGTGTGCACGTGTGTGCTTGGG + Intronic
1152737880 17:82006277-82006299 GCGGGTGCACGTGCGTGTTTGGG + Intronic
1152859882 17:82690184-82690206 GAGTGTGCATGTGTGTCCAGGGG + Intronic
1152859904 17:82690342-82690364 GAGTGTGTACGTGTGTCCAGGGG + Intronic
1152859910 17:82690392-82690414 GAGTGTGCACATGTGTTCTCAGG + Intronic
1152859919 17:82690472-82690494 GAGTGTGCACGTGTGTTGCCGGG + Intronic
1152859929 17:82690552-82690574 GAGTGTGCACGTGTGTTGCCGGG + Intronic
1152859934 17:82690582-82690604 GAGTGTGCACGTGTGTCCAGGGG + Intronic
1152859947 17:82690662-82690684 GAGTGTGCACGTGTGTGCAGGGG + Intronic
1152859958 17:82690741-82690763 GAGTGTGCACGTGTGTCCAGGGG + Intronic
1152859969 17:82690820-82690842 GAGTGTGCACGTGTGTCCAGGGG + Intronic
1152998652 18:432643-432665 GTGTGTGCATGTGTATTTTGTGG - Intronic
1153294789 18:3535096-3535118 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1153325525 18:3815400-3815422 GTGTGTGCACGGGTGTGCAGAGG - Intronic
1153539545 18:6139480-6139502 GTGTGTGCATGTGTGTTTAGGGG - Intronic
1153943380 18:9996051-9996073 GTGCATGCACGTGTGTGTTGGGG + Intergenic
1154080252 18:11249146-11249168 GTGTGTGCATGTGTGTGCAGTGG - Intergenic
1154211566 18:12383514-12383536 GTGTGTGAGTGTGTGTGTTGTGG + Intergenic
1154227451 18:12519329-12519351 GTGTGTGCACATGTGTGTATAGG - Intronic
1154496767 18:14966896-14966918 GAGTGTGTGAGTGTGTGTGGTGG + Intergenic
1155075574 18:22351183-22351205 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1155116571 18:22774150-22774172 GCGTGTGCGTGTGTGTGTGGGGG + Intergenic
1155323939 18:24647142-24647164 GAGTGTGTATGTGCATGTTGGGG - Intergenic
1155360896 18:25000986-25001008 GTGTGTGCACGTGTGTATTTAGG + Intergenic
1155533127 18:26787883-26787905 GTGTGTGCAATTGTGTGTTATGG + Intergenic
1155618736 18:27751310-27751332 GTGTGTGCATGTGTGTGTGTGGG + Intergenic
1155661137 18:28249501-28249523 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1155743624 18:29322438-29322460 ATGTGTGCATGTGTGTGTTTAGG + Intergenic
1155760783 18:29563097-29563119 GTGTGTGTGTGTGTGTGTTGTGG - Intergenic
1156170378 18:34476406-34476428 GTGTGTGTGTGTGTGTGTTGAGG - Intergenic
1156524620 18:37755102-37755124 GAGAGGGCACCTATGTGTTGGGG - Intergenic
1156590053 18:38477149-38477171 GTGTGTGTGTGTGTGTGTTGAGG + Intergenic
1156669612 18:39452568-39452590 GTATGTGCATGTGTGTGTAGGGG - Intergenic
1156754373 18:40503812-40503834 GAGAATGCAAGTGTGAGTTGAGG - Intergenic
1156789773 18:40956674-40956696 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1156801031 18:41114200-41114222 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1156917255 18:42476402-42476424 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1157113759 18:44844326-44844348 GTGTGTGCACGTGTGTGTGTGGG - Intronic
1157290447 18:46406136-46406158 GAGTGTCTGCATGTGTGTTGGGG - Intronic
1157421669 18:47552991-47553013 GTGTGTGCATGTGTGTATTGAGG + Intergenic
1157588780 18:48822501-48822523 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1157791440 18:50535219-50535241 GTGTGTGTATGTGTGTGGTGTGG + Intergenic
1157791450 18:50535284-50535306 GTGTGTGTATGTGTGTGGTGTGG + Intergenic
1158109124 18:53920420-53920442 GTGTGTGCACGTGTGTGTATGGG + Intergenic
1158120006 18:54038436-54038458 GCGTGTGCATGTGTGTGTGTGGG - Intergenic
1158262424 18:55622887-55622909 GTGTGTGTGTGTGTGTGTTGTGG + Intronic
1158429205 18:57368963-57368985 GTGTGTGTATGTGTGTGTGGGGG - Intronic
1158548138 18:58413266-58413288 GATTGTGGTCTTGTGTGTTGTGG - Intergenic
1158819318 18:61140982-61141004 GTGTGTGTGTGTGTGTGTTGAGG - Intergenic
1158887938 18:61846528-61846550 GAATGTGCATCTGTGAGTTGGGG - Intronic
1158939523 18:62394015-62394037 GTGTGTGCGTGTGTGTGTGGTGG - Intergenic
1159016186 18:63103330-63103352 GTGTGTGCAGGTGTGTAGTGTGG + Intergenic
1159690040 18:71476500-71476522 GTGTGTGTGTGTGTGTGTTGAGG - Intergenic
1159831702 18:73285190-73285212 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1159903873 18:74073133-74073155 GTGTGTGTATGTGTGTGTAGGGG - Intergenic
1159963649 18:74575739-74575761 GTGTGTGCGCGTGTGTGAAGGGG + Intronic
1160135767 18:76270219-76270241 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1160159980 18:76463689-76463711 CAGTGGGCACGTCTGCGTTGCGG - Intronic
1160350215 18:78172209-78172231 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1160357892 18:78244193-78244215 GTGTGTGCGCGTGTGTGAAGTGG - Intergenic
1160404551 18:78636675-78636697 GAGTGTGCATGGGTGTGTAGAGG + Intergenic
1160523278 18:79521059-79521081 GTGTGTCCATGTGTGTGTGGGGG + Intronic
1160523296 18:79521173-79521195 GTGTGTCCATGTGTGTGTGGGGG + Intronic
1160523308 18:79521245-79521267 GTGTGTCCATGTGTGTGTGGGGG + Intronic
1161094424 19:2381362-2381384 GCGTGTGTGTGTGTGTGTTGGGG + Intergenic
1161248271 19:3267105-3267127 GTGCGTGTGCGTGTGTGTTGGGG + Intronic
1161322777 19:3648967-3648989 GTGTGTGCATGTGTGTGTCCAGG - Intronic
1161901055 19:7119839-7119861 GTGTGTGCGTGTGTGTGTTTGGG - Intronic
1161967683 19:7557325-7557347 GCGTGTGCGTGTGTGTGGTGCGG - Intronic
1162015291 19:7842902-7842924 GTGTGTGCATGTGTGTGTGAAGG + Intronic
1162015320 19:7843328-7843350 GAGTGTGCATGTGTGTGTATAGG + Intronic
1162015345 19:7843646-7843668 GTGTGTGCATGTGTGTGTATAGG + Intronic
1162089344 19:8268809-8268831 GAGAGTGCCTTTGTGTGTTGGGG + Intronic
1162301531 19:9847698-9847720 GTGTGTGCATGTGTGTGTGCTGG + Intronic
1162777254 19:12987414-12987436 GAGTGTGCCTGTGTATGTTTGGG + Intergenic
1163369253 19:16892888-16892910 GTGTGTGCATGTGTGTGTCCCGG - Intergenic
1163502462 19:17684813-17684835 GAGTCTGCACATGTGTGTCTAGG + Intronic
1164024394 19:21338079-21338101 GTGTGTGTTTGTGTGTGTTGGGG - Intergenic
1164519482 19:28967634-28967656 GAGTGTGCATGTGTGTGGGTGGG + Intergenic
1164713563 19:30375873-30375895 GTGTGTGCGTGTGTGTGTTAGGG + Intronic
1165137936 19:33682153-33682175 GTGTGTGTGTGTGTGTGTTGTGG + Intronic
1165153743 19:33775310-33775332 GCGTCTGCATGTGTGTGTCGGGG + Intergenic
1165511614 19:36269535-36269557 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1165512713 19:36274557-36274579 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1165513264 19:36277100-36277122 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1165513819 19:36279653-36279675 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1165514368 19:36282187-36282209 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1165514922 19:36284726-36284748 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1165515474 19:36287257-36287279 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1165516024 19:36289795-36289817 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1165516575 19:36292330-36292352 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1165517127 19:36294858-36294880 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1165517679 19:36297381-36297403 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1165518232 19:36299916-36299938 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1165518783 19:36302451-36302473 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1165519331 19:36304981-36305003 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1165519880 19:36307496-36307518 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1165593088 19:36987834-36987856 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1165624184 19:37271097-37271119 GGGTGTGTGTGTGTGTGTTGGGG - Intergenic
1165624730 19:37273625-37273647 GGGTGTGTGTGTGTGTGTTGGGG - Intergenic
1165625272 19:37276163-37276185 GGGTGTGTGTGTGTGTGTTGGGG - Intergenic
1165625801 19:37278687-37278709 GGGTGTGTGTGTGTGTGTTGGGG - Intergenic
1165626345 19:37281215-37281237 GGGTGTGTGTGTGTGTGTTGGGG - Intergenic
1165626885 19:37283740-37283762 GGGTGTGTGTGTGTGTGTTGGGG - Intergenic
1165627427 19:37286264-37286286 GGGTGTGTGTGTGTGTGTTGGGG - Intergenic
1165627963 19:37288788-37288810 GGGTGTGTGTGTGTGTGTTGGGG - Intergenic
1165628504 19:37291314-37291336 GGGTGTGTGTGTGTGTGTTGGGG - Intergenic
1165629044 19:37293837-37293859 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1165629587 19:37296365-37296387 GGGTGTGTGTGTGTGTGTTGGGG - Intergenic
1165630129 19:37298892-37298914 GGGTGTGTGTGTGTGTGTTGGGG - Intergenic
1165630672 19:37301430-37301452 GGGTGTGTGTGTGTGTGTTGGGG - Intergenic
1165922247 19:39306726-39306748 GTGTGTGTGTGTGTGTGTTGGGG - Exonic
1165984614 19:39757197-39757219 GTGTGTGCCTGTGTGTGTTGGGG + Intergenic
1166196185 19:41207340-41207362 GAGTGTGTATGTGTGTGTGGAGG - Exonic
1167014285 19:46830191-46830213 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1167103465 19:47417920-47417942 GTGTGTGCATGTGTGTGTGGGGG - Intronic
1167112902 19:47472190-47472212 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1167574658 19:50312306-50312328 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1168018783 19:53594305-53594327 GGCTGTGCAGGTGTGTGTTGTGG + Intergenic
1168059203 19:53882070-53882092 GTGTGTGCACGTGTGGGGGGCGG + Intronic
1168311447 19:55463035-55463057 CTGTGTGCATGTGTGTGTTTTGG - Intergenic
1168317010 19:55488898-55488920 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
925059230 2:878332-878354 GAGTGTGCGTGTGTGTGTAGGGG - Intergenic
925059247 2:878429-878451 GAGTGTGCGTGTGTGTGTGTAGG - Intergenic
925059258 2:878487-878509 GAGTGTGCATGTGTATGTAGGGG - Intergenic
925059265 2:878527-878549 GGGCGTGCATGTGTGTGTAGTGG - Intergenic
925126629 2:1461699-1461721 CTGTGTGCACGTGTGTGTATGGG - Intronic
925126633 2:1461756-1461778 GTGTGTGCAGGTGTGTGTGTGGG - Intronic
925319678 2:2952454-2952476 GTGTGTGCATGTGCGTGTTGGGG - Intergenic
925461881 2:4070312-4070334 GAGTGTGCACATTTGTGCTTGGG + Intergenic
925462033 2:4072006-4072028 AAGTGTGCATGTGTGTGTGGTGG + Intergenic
925465888 2:4107070-4107092 GCGCGTGCATGTGTGTGTAGGGG + Intergenic
925542930 2:4985569-4985591 GCGTGCTCACGTGTGTGTTTTGG - Intergenic
925779648 2:7370367-7370389 GTGTGTGTATGTGTGTGTTATGG - Intergenic
926122495 2:10252429-10252451 GTGTGTGCATGTGCGTGTGGTGG + Intergenic
926152659 2:10433557-10433579 ATGTGTACATGTGTGTGTTGTGG + Intergenic
926906129 2:17807377-17807399 GTGTGTGCTCGTGTGTGTTGGGG - Intergenic
927322883 2:21768930-21768952 GAGTGTGTGTGTGTGTGTTTGGG + Intergenic
927472564 2:23386425-23386447 AAGTGTGCGTGTGTGTGTCGGGG - Intronic
927678421 2:25123783-25123805 GTGTGTGCACGTGTGTGCAGTGG - Intronic
927684934 2:25163974-25163996 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
927800259 2:26092305-26092327 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
928171307 2:29005288-29005310 GTGTGTGCATGTGTGTGTGTGGG + Intronic
928171982 2:29010039-29010061 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
928281079 2:29946946-29946968 GTGTGTGTGTGTGTGTGTTGAGG + Intergenic
928326440 2:30323079-30323101 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
928586344 2:32762311-32762333 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
928592058 2:32827386-32827408 GAGTGTGCACATGTGTACTTGGG - Intergenic
928611211 2:32993992-32994014 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
928667752 2:33567560-33567582 GTGTGTGTATGTGTGTTTTGAGG - Intergenic
928689193 2:33781600-33781622 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
928729631 2:34216178-34216200 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
929011017 2:37444876-37444898 GGGTGTGTATGTGTGTGTAGGGG - Intergenic
929315855 2:40477753-40477775 GTGTGTGCACGTGTGTGTAGGGG + Intronic
929360185 2:41078797-41078819 GTGTGTGCATGTGTGTGTGTGGG - Intergenic
929414044 2:41729520-41729542 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
929544257 2:42845497-42845519 GAGTGTGAGAGCGTGTGTTGAGG + Intergenic
929581802 2:43086054-43086076 GTGTGTGCACGTGTGTGGTGGGG - Intergenic
929761153 2:44807745-44807767 GAGACTGCACGTCTGTGTTCTGG + Intergenic
929774511 2:44920371-44920393 GTGTGTGTGTGTGTGTGTTGTGG + Intergenic
929774517 2:44920411-44920433 GTGTGTGTGTGTGTGTGTTGTGG + Intergenic
929872610 2:45771729-45771751 GTGTGTGTGAGTGTGTGTTGGGG + Intronic
929878557 2:45817093-45817115 GTGTGTGTGTGTGTGTGTTGTGG + Intronic
930004923 2:46889041-46889063 GTGTGTGTGTGTGTGTGTTGTGG + Intergenic
930400378 2:50877168-50877190 GTGTGTCTATGTGTGTGTTGGGG - Intronic
930920176 2:56743694-56743716 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
931072989 2:58675245-58675267 GTGCAAGCACGTGTGTGTTGTGG + Intergenic
931235819 2:60411917-60411939 GAGTGTGCATGTGTATGTCTGGG + Intergenic
931355906 2:61537748-61537770 GTGTGTGTGTGTGTGTGTTGGGG - Exonic
931463624 2:62468565-62468587 GTGGGTGCATGTGGGTGTTGGGG + Intergenic
931877264 2:66527624-66527646 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
931937357 2:67214031-67214053 GGGTGTGTATGTGTGTGTAGGGG - Intergenic
931969443 2:67569359-67569381 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
931987418 2:67755307-67755329 GTGTATGTGCGTGTGTGTTGGGG + Intergenic
932099191 2:68881039-68881061 GTGTGTGCCTGTGTGTGTTGGGG - Intergenic
932105274 2:68936275-68936297 GAGTGTGAAGGTGGGTGGTGTGG + Intergenic
932111729 2:69008083-69008105 GCGTGAGTATGTGTGTGTTGTGG - Intergenic
932129626 2:69176080-69176102 GTGTGTGTATGTGTGTGTGGGGG - Intronic
932184673 2:69683651-69683673 GAGTGTGCAGGTATGTATGGAGG - Intronic
932188497 2:69718644-69718666 GTGTATGCATGTGTGTGCTGTGG - Intronic
932300673 2:70664729-70664751 GAGTGTGCAAGTGTGTGTGTGGG + Intronic
932475495 2:72003358-72003380 CAGTGTGCAGGTGTGTGTGAGGG + Intergenic
932625163 2:73291624-73291646 GGGTGCGCACGTGCGTGGTGAGG + Exonic
932627636 2:73311096-73311118 GTGTGTGTACGTGTGTGTATGGG + Intergenic
932702925 2:74003188-74003210 GTGTGTGTGCGTGTGTGTGGTGG + Intronic
932766871 2:74476040-74476062 GTGTGTGTGTGTGTGTGTTGCGG - Intronic
932961561 2:76418358-76418380 GAGAGTGCATGTGTGTGTGATGG + Intergenic
933009945 2:77048229-77048251 GTGTGTGCATGTGTGTGTAATGG + Intronic
933308556 2:80632273-80632295 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
933704949 2:85282826-85282848 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
934032525 2:88061161-88061183 GTGTGTGTATGTGTGTGTTGGGG + Intergenic
934032531 2:88061199-88061221 GTGTGTGTATGTGTGTGTTGGGG + Intergenic
934550621 2:95259301-95259323 GAGTGTGTATGTGTGTATTTGGG + Intronic
934758602 2:96841087-96841109 GTGTGTGAGCGTGTGTGTTATGG + Intronic
935066026 2:99648870-99648892 GTGTGTGCGCGCGTGTTTTGAGG - Intronic
935332526 2:101987597-101987619 GTAGGTGCACGTGTGTGTTTAGG - Intergenic
935346407 2:102112338-102112360 GAGTGTGAGTGTGTGTGTTGTGG + Intronic
935390566 2:102548086-102548108 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
935467873 2:103420851-103420873 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
935645174 2:105329066-105329088 GAGTAGGCAGGGGTGTGTTGGGG - Intronic
935842976 2:107133626-107133648 GAGTGTGTACATGTGTGTGTTGG + Intergenic
935842978 2:107133628-107133650 GTGTGTACATGTGTGTGTTGGGG + Intergenic
935962498 2:108440677-108440699 GTGTGTGTATGTGTGTGTGGGGG - Intergenic
936075672 2:109400199-109400221 ATGTGTGCAAGTGTGTGTAGGGG - Intronic
936675949 2:114714127-114714149 GAGTGTGTCTGTGTGTGTTGGGG + Intronic
936849656 2:116880289-116880311 GAATGTGGACATGTGTGTTATGG + Intergenic
936899803 2:117469936-117469958 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
937087776 2:119182608-119182630 GCGTGTGTAAGTGTGTGTTGGGG - Intergenic
937233328 2:120415462-120415484 GTGTGTACACGTGTGTTTGGAGG + Intergenic
937260834 2:120586079-120586101 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
937501973 2:122489097-122489119 GTGTGTGTGTGTGTGTGTTGAGG + Intergenic
937512225 2:122608954-122608976 GTGTGTGCATGTGTGTGTGTAGG - Intergenic
937601974 2:123748473-123748495 AAGAGTGCATGTGTGAGTTGGGG + Intergenic
937634346 2:124139259-124139281 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
937645740 2:124264359-124264381 GTGTGTGCCTGTGTGTGTGGGGG - Intronic
937711128 2:124981313-124981335 GTGTGCACACGTGTGTGTTTAGG + Intergenic
937817390 2:126266857-126266879 GTGTATGTGCGTGTGTGTTGGGG - Intergenic
937950854 2:127387381-127387403 GTGTGCGCGCGTGTGTGTCGGGG - Intronic
938278343 2:130047892-130047914 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
938329316 2:130438697-130438719 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
938410030 2:131055875-131055897 GTGCATGCACGTGTGTGTGGTGG + Intronic
938437033 2:131289494-131289516 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
938755526 2:134375766-134375788 GATTGTCCACATGTGGGTTGGGG + Intronic
938784472 2:134612538-134612560 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
939159294 2:138567417-138567439 GTGTGTGTGTGTGTGTGTTGCGG + Intronic
939704263 2:145432463-145432485 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
939993029 2:148894015-148894037 GTGTGTGTATGTGTGTGTGGTGG - Intronic
940051326 2:149468128-149468150 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
941264961 2:163349242-163349264 GTGTGTGTGCGTGTGTGTAGAGG - Intergenic
941298591 2:163772532-163772554 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
941928846 2:170921552-170921574 GAGGGTGTGTGTGTGTGTTGGGG - Intergenic
942022169 2:171876678-171876700 AAGTGTGTATGTGTGTGTGGGGG - Intronic
942264728 2:174211176-174211198 GTGTGTGTGTGTGTGTGTTGTGG - Intronic
942305123 2:174599773-174599795 GAGTGTGTGTGTGTGTGTTTGGG - Intronic
942374065 2:175317941-175317963 GCATGTGCATGTGTGTGCTGAGG + Intergenic
942396239 2:175552703-175552725 GTGTGTTCACTTGGGTGTTGGGG - Intergenic
942406667 2:175663246-175663268 CTATGTGCACGTGTGTGTGGAGG - Intergenic
942865439 2:180668011-180668033 GTGTGTGCATGTGTGTGTTATGG + Intergenic
942874466 2:180777620-180777642 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
942885546 2:180919352-180919374 GTGTGTGTATGTGTGTGTTTTGG - Intergenic
943537530 2:189171125-189171147 GTGTGTGTCTGTGTGTGTTGGGG + Intronic
943842061 2:192595978-192596000 TAGTGTGCATGTGTGTGTGAGGG - Intergenic
944040920 2:195353531-195353553 TAGTGTGGATGTGTGTGTCGTGG - Intergenic
944348232 2:198694707-198694729 GTGTGTGTGTGTGTGTGTTGAGG - Intergenic
945712124 2:213310315-213310337 GTGTGTGTGTGTGTGTGTTGTGG - Intronic
945877360 2:215292458-215292480 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
946414972 2:219535362-219535384 CTGTGTGTACGTGTGTGTGGGGG + Intronic
946505881 2:220300163-220300185 GAGTGACCACCTGTGGGTTGGGG + Intergenic
946865900 2:224040280-224040302 GAGTGTGCACGTGTGTGTTGGGG + Intergenic
946925927 2:224626819-224626841 GTGTGTGTCTGTGTGTGTTGGGG - Intergenic
947000693 2:225452780-225452802 ACGTGTGCATGTGTGTGGTGGGG - Intronic
947077383 2:226360097-226360119 GTGTGTGTATGTGTGTATTGGGG - Intergenic
947084381 2:226434773-226434795 GTGTGTGTACATGTGTGTGGAGG - Intergenic
947099019 2:226598979-226599001 GCATGTGCATGTGTGTGTAGAGG + Intergenic
947395638 2:229684194-229684216 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
947693133 2:232158329-232158351 GTGTGTGCATGTGTGTGTTCGGG + Intronic
947793661 2:232881285-232881307 GAGTGTGCAGGTGGGTAGTGCGG - Intronic
947917575 2:233843864-233843886 GTGTGTGCACGTGTGTGGCAGGG + Intronic
948032993 2:234834833-234834855 GAGTGTGTGTGTTTGTGTTGGGG - Intergenic
948226302 2:236311720-236311742 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
948231757 2:236354333-236354355 TAGTGTGCATGTGTGTGTGTGGG + Intronic
948271023 2:236673308-236673330 GAGTGTGTACATGTGTGGGGGGG + Intergenic
948300376 2:236901972-236901994 GAGTGTGCACGTGGGCATTTTGG + Intergenic
948304739 2:236938265-236938287 GTGTGTGCATGTGTGTGGTGTGG + Intergenic
948460036 2:238124591-238124613 GAGAGTGTACGTGTGTGTGCAGG + Intronic
948563834 2:238871098-238871120 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
948637103 2:239345588-239345610 GTGTGTGTATGTGTGTGTTAGGG - Intronic
948682344 2:239644114-239644136 GTGTGTGATCGTGTGTGGTGTGG + Intergenic
948743250 2:240062897-240062919 GTGCGTGCATGTGTGTGTGGTGG + Intergenic
949029556 2:241786153-241786175 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1169204726 20:3733158-3733180 GAGTGTATGTGTGTGTGTTGGGG + Intronic
1169582459 20:7039256-7039278 GTATGGGTACGTGTGTGTTGGGG + Intergenic
1169746440 20:8947766-8947788 CAGTGTGCAAGTTTTTGTTGTGG + Intronic
1170045629 20:12082423-12082445 GTGTGTGCACGTGTGTGTCTGGG - Intergenic
1170210774 20:13844380-13844402 GTGTGTGTGCGTGTGTGTAGCGG + Intergenic
1170393647 20:15902919-15902941 GAGTGAGCCTGTGTGTGTGGTGG + Intronic
1170784053 20:19452408-19452430 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1170830643 20:19837165-19837187 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1171013465 20:21521288-21521310 TAGTGTGTGCGTGTGTGTTGTGG + Intergenic
1171109985 20:22471910-22471932 ATGTGTGCACGGGTGTGCTGTGG - Intergenic
1171179082 20:23078563-23078585 GTGTGTGGGTGTGTGTGTTGGGG + Intergenic
1171249053 20:23634977-23634999 GTGTGTGCACATATGTGTGGGGG - Intronic
1171435422 20:25118355-25118377 GGATGTGCACGTGAGTGTGGTGG - Intergenic
1171896767 20:30815572-30815594 GAGTGTGCTCGTTTGTCTGGCGG + Intergenic
1172135397 20:32683241-32683263 GTGTGTGTGTGTGTGTGTTGTGG - Intergenic
1172195322 20:33087713-33087735 GTGTGTGTGTGTGTGTGTTGAGG - Intronic
1172594769 20:36143165-36143187 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1172648396 20:36485977-36485999 GACTGTGCTCCTGTGTGTGGTGG + Intronic
1172876210 20:38165667-38165689 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1172936997 20:38627537-38627559 GTGTGTGTTGGTGTGTGTTGGGG + Intronic
1173028669 20:39333925-39333947 GTGTGTGCATGTGTGTGTGCAGG - Intergenic
1173081668 20:39874317-39874339 GAGTGGGCAGGTGAGTGTTTAGG - Intergenic
1173104328 20:40118840-40118862 GAATCTGCATGTGTTTGTTGAGG - Intergenic
1173585918 20:44183010-44183032 GCGTGTGTATGTGTGTGTTTTGG - Intronic
1173882289 20:46424615-46424637 GTGTGTGCGTGTGTGTGTAGGGG + Intronic
1173969379 20:47139853-47139875 AAGTTTGCATGTGTGTGTTGGGG - Intronic
1174407270 20:50310504-50310526 GTGTGTGCACGTATGGGGTGGGG + Intergenic
1174561489 20:51433771-51433793 GTGTGTGTGTGTGTGTGTTGTGG + Intronic
1174786984 20:53442180-53442202 GTGTGTGTACGTGTGTGTAAAGG + Intronic
1174829520 20:53799784-53799806 GAGTGTGTGTGTGTGTGTTGGGG - Intergenic
1174889869 20:54380063-54380085 ATGTGCGCACGTGTGTGTGGGGG - Intergenic
1175032499 20:55969816-55969838 GTGGGTGGACGTGGGTGTTGGGG - Intergenic
1175082153 20:56429601-56429623 GAGTGTGTATGTATGTGTTGGGG - Intronic
1175161591 20:57011871-57011893 GTGTGCGTGCGTGTGTGTTGTGG + Intergenic
1175219967 20:57411316-57411338 GTGTGTGCACATGTGTGTCTGGG - Intergenic
1175314938 20:58040545-58040567 GTGTGTGCATGTGTGTGTGTGGG - Intergenic
1175485267 20:59341592-59341614 GTGTGTGCATGTGTGTATGGGGG + Intergenic
1175599201 20:60259009-60259031 GTGTGTGTGTGTGTGTGTTGCGG + Intergenic
1175643389 20:60650035-60650057 GTGAGTACACGTGTGTGTTTAGG + Intergenic
1175657352 20:60782620-60782642 GAGCGTGCACACGTGTGTGGCGG + Intergenic
1175720462 20:61283379-61283401 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1175720463 20:61283418-61283440 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1175720464 20:61283457-61283479 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1175720470 20:61283568-61283590 GCATTTGCACGTGTGTGCTGTGG + Intronic
1175720471 20:61283607-61283629 GCATTTGCACGTGTGTGCTGTGG + Intronic
1175776384 20:61656396-61656418 GAGTGAGCAGGTGTATGCTGAGG + Intronic
1175814385 20:61875933-61875955 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1175850420 20:62087930-62087952 GAGTGTGCAGGTGAGTGTACAGG - Intergenic
1175876018 20:62230398-62230420 GTGTGTGTATGGGTGTGTTGAGG - Intergenic
1176020018 20:62957857-62957879 GCGTGTGCAAGTGTGTGTATGGG + Intronic
1176047119 20:63098507-63098529 GAGGGTTCCAGTGTGTGTTGGGG - Intergenic
1176110661 20:63409313-63409335 GTGTGTGCATGTGTGTGTGTAGG + Intronic
1176275993 20:64269694-64269716 GAGTGTAGACGTGTGTGGTGTGG + Intronic
1176386486 21:6140689-6140711 GCGTGTGCCCGTGTGTGCTTGGG + Intergenic
1177891795 21:26813570-26813592 GGGTGTGTATGTGTGTGTGGAGG + Intergenic
1178224694 21:30701790-30701812 GTGTGTGTGTGTGTGTGTTGAGG + Intergenic
1178359578 21:31937082-31937104 GTGTATGCATGTGTGTGTTTCGG + Intronic
1178586453 21:33875014-33875036 GAGTCTGCATGTGTGGCTTGGGG + Intronic
1178716008 21:34964975-34964997 GAGTGTGCTTGTGTGTGGTAGGG - Intronic
1178750477 21:35297721-35297743 GTGTGTGCATGTGTGTGAGGGGG - Intronic
1178844728 21:36165424-36165446 GTGTGTGCATGTGTGTGTATGGG + Intronic
1179144883 21:38759250-38759272 GTGTGTGCATGTGTGTGTGTGGG - Intergenic
1179191439 21:39125669-39125691 GTGTGAGTACATGTGTGTTGGGG - Intergenic
1179413480 21:41179568-41179590 GTGAGTGCACATGTGTGGTGAGG + Intronic
1179736987 21:43397563-43397585 GCGTGTGCCCGTGTGTGCTTGGG - Intergenic
1179827550 21:43975386-43975408 GTGTGTGCACTGGTGTGTGGTGG + Intronic
1179914203 21:44465941-44465963 GAGCATGCACGTGTGTGTACAGG - Intergenic
1179998322 21:44984156-44984178 GTGTGTGGGCGTGTGTGTGGGGG - Intergenic
1180611535 22:17101350-17101372 GTGTGTGCACGCGTGTGTGCAGG - Intronic
1180889276 22:19274002-19274024 GGGTGTGTGTGTGTGTGTTGTGG - Intronic
1180950295 22:19717762-19717784 GTGTGTGCATGTGTGTTTGGTGG - Intronic
1181596730 22:23920123-23920145 GTGTGTGCGCGTGTGTGTGATGG + Intergenic
1181610870 22:24011072-24011094 GTGTGTGTGTGTGTGTGTTGCGG - Intergenic
1181746312 22:24957179-24957201 GTGTGTGCCTGTGTGTGTTGGGG + Intronic
1181911262 22:26240041-26240063 ATGTGTGTATGTGTGTGTTGAGG - Intronic
1182012661 22:27013741-27013763 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1182149932 22:28020774-28020796 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1182381617 22:29894520-29894542 GTGTGTGTGTGTGTGTGTTGTGG + Intronic
1182667253 22:31968804-31968826 GTGTGTGTGCGTGTGTGTTGGGG - Intergenic
1182723488 22:32423590-32423612 GTGTGTGTGTGTGTGTGTTGTGG + Intronic
1182815558 22:33160264-33160286 GTGTGTGTATGTGTATGTTGAGG + Intergenic
1182966899 22:34530562-34530584 GTGTGTGCATGTGTGTGTTTGGG + Intergenic
1183062139 22:35342707-35342729 GTGTGTGGAGGTGTGTGTGGTGG - Intronic
1183062151 22:35342778-35342800 GTGTGTGGAGGTGTGTGTGGTGG - Intronic
1183062187 22:35343021-35343043 GTGTGTGGAGGTGTGTGTGGTGG - Intronic
1183062206 22:35343144-35343166 GTGTGTGGAGGTGTGTGTGGTGG - Intronic
1183062221 22:35343242-35343264 GTGTGTGGAGGTGTGTGTGGTGG - Intronic
1183062252 22:35343439-35343461 GTGTGTGTAGGTGTGTGTGGTGG - Intronic
1183062263 22:35343544-35343566 GTGTGTGTAGGTGTGTGTGGTGG - Intronic
1183265341 22:36821519-36821541 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1183278190 22:36914564-36914586 GTGTGTGCAGGTGTGTGTACTGG + Intronic
1183327174 22:37200606-37200628 GAGTGCACACCTGTGTGTGGAGG - Intergenic
1183343673 22:37295363-37295385 GTGTGTGCATGTGTGTGGTGGGG - Intronic
1183387181 22:37521501-37521523 GAGTGTGCAAGCGTGTGATTAGG + Intergenic
1183588233 22:38765528-38765550 GTGTGTGCACCTGTGTCTGGAGG - Intronic
1184128942 22:42505721-42505743 GTGTGTGCGCGTGCGTGTGGTGG - Intergenic
1184136758 22:42554271-42554293 GAGCGTGCGCGTGGGTGTCGGGG + Intronic
1184137737 22:42559036-42559058 GTGTGTGCGCGTGCGTGTGGTGG - Intronic
1184250135 22:43255419-43255441 GTGTGTGCACATGTGTGTCTCGG - Intronic
1184265676 22:43344493-43344515 GTGTGTGCGTGTGTGTGTTGGGG - Intergenic
1184288469 22:43485661-43485683 TAGTGTGCACACGTGTGTTGAGG - Intronic
1184523533 22:45009015-45009037 GCGTGCGCGTGTGTGTGTTGGGG - Intronic
1184796259 22:46735072-46735094 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1184914944 22:47562951-47562973 GTGTGTGTATGTGTGTGTAGGGG + Intergenic
1184924645 22:47628611-47628633 GTGTGTGCATGTGTGCATTGTGG + Intergenic
1184924652 22:47628761-47628783 GCATGTGAGCGTGTGTGTTGTGG + Intergenic
1184924666 22:47628913-47628935 GCATGTGAGCGTGTGTGTTGTGG + Intergenic
1184924686 22:47629105-47629127 GCATGTGCATGTGTGTGATGTGG + Intergenic
1184968470 22:47998209-47998231 GGGTGTGTGCCTGTGTGTTGGGG - Intergenic
1185079966 22:48704185-48704207 GTGTGTGCGCGTGTGTGTTGAGG - Intronic
1185188549 22:49418059-49418081 GCGGGTGCACGTGTGGGGTGTGG - Intronic
1185203999 22:49526348-49526370 GTGTGTGCACCTGTGTGTGCAGG + Intronic
949141858 3:643629-643651 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
949265202 3:2148954-2148976 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
949382075 3:3457695-3457717 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
949528324 3:4928391-4928413 GTGTGTGTGCGTGTGTGTTGTGG + Intergenic
949608074 3:5676092-5676114 GACTGTTCAGGTGTGTGTGGTGG - Intergenic
949751698 3:7359238-7359260 GTGTGTGTGTGTGTGTGTTGTGG + Intronic
949905667 3:8856352-8856374 GTGTGTGTGCGTGTGTGTGGGGG + Intronic
949980858 3:9500936-9500958 GTGTGTGTGTGTGTGTGTTGGGG - Exonic
950053976 3:10011080-10011102 GAGAGTGCCCGCCTGTGTTGGGG + Intronic
950650365 3:14403221-14403243 CAGCGTGCACATGTGTGTTCCGG + Intronic
951014988 3:17721471-17721493 GTGTGTGTGTGTGTGTGTTGTGG + Intronic
951118125 3:18889682-18889704 GTGTGTGTGTGTGTGTGTTGTGG + Intergenic
951465542 3:22997167-22997189 GTGTGTGTGTGTGTGTGTTGTGG - Intergenic
951685376 3:25338092-25338114 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
952056288 3:29450888-29450910 GTGTGTGTATCTGTGTGTTGAGG - Intronic
952276581 3:31883185-31883207 GTGTCTGCAGGTGTGTGTAGGGG - Intronic
952748124 3:36801280-36801302 GAGTTTGCATGTGTGTGTCAGGG + Intergenic
952981052 3:38736389-38736411 GTGTGTGTGTGTGTGTGTTGTGG + Intronic
952986379 3:38788602-38788624 GAGTGAGTGTGTGTGTGTTGGGG + Intronic
953004836 3:38968579-38968601 GTGTGTGCACATGTGTGTTGGGG - Intergenic
953294507 3:41700435-41700457 GAGTGTGAATGTGTGTGGAGGGG - Intronic
953369298 3:42373547-42373569 GGGTGTGCATGTGTGTGTGCAGG + Intergenic
953384811 3:42500515-42500537 GTGTGTGTATGTATGTGTTGAGG + Intronic
953412878 3:42700008-42700030 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
953412895 3:42700174-42700196 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
953631291 3:44620362-44620384 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
953743181 3:45554348-45554370 ACGTGTGCATGTGTGTGGTGTGG - Intergenic
953748864 3:45594774-45594796 GTGTGTGTGTGTGTGTGTTGAGG - Intronic
953914290 3:46908802-46908824 GGATGTGCACGTGTGTGTGCAGG + Intergenic
954248692 3:49351972-49351994 GAGTGTGTCTGTGTGTGTTGGGG + Intergenic
954401870 3:50323290-50323312 GAGTGTGACTGTGTGGGTTGGGG + Intronic
954422143 3:50424439-50424461 GAGCGCGTGCGTGTGTGTTGGGG - Intronic
954590345 3:51777370-51777392 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
954594227 3:51811636-51811658 GTGTGTGCATGTGTGAGGTGTGG - Intergenic
954745545 3:52785607-52785629 GTATGTGCACCTGTGTGTGGTGG + Intronic
955327422 3:58020079-58020101 GTGTGTGTGTGTGTGTGTTGAGG + Intronic
955826997 3:62958064-62958086 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
955880631 3:63540926-63540948 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
956369196 3:68539704-68539726 GTGTGTGCATGTGTGTGGTGGGG + Intronic
956456512 3:69426336-69426358 GTGTGTGCATGTGTGTGTGTTGG + Intronic
956739784 3:72266815-72266837 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
957363875 3:79196353-79196375 GCGTGTGCATGTGTGTGTGATGG - Intronic
957468366 3:80625190-80625212 AAGTGTGCGTGTGTGTGTCGGGG - Intergenic
957597289 3:82283624-82283646 AAGTGTGCACTTGTGTGTGGTGG - Intergenic
957605819 3:82397920-82397942 GTATGCGCACGTGTGTGTTTTGG - Intergenic
957616212 3:82530818-82530840 GAGAGAGCAAGTGTGTGCTGAGG + Intergenic
957747946 3:84368947-84368969 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
958010148 3:87866840-87866862 GTGTGTGCGTGTGTGTGTTCAGG + Intergenic
958109335 3:89119761-89119783 GTATGTGCACATGTGTGTTTGGG + Intronic
958612601 3:96446731-96446753 TAGTGTGTATGTGTGTGTGGGGG - Intergenic
959117683 3:102196878-102196900 GTGTGTGCACATGTGTGTGATGG - Intronic
959158993 3:102700953-102700975 GTGTGTGCACATGTGTGTGATGG - Intergenic
959513169 3:107236429-107236451 GCGTGTGTGTGTGTGTGTTGGGG - Intergenic
959679149 3:109072930-109072952 GTGTGTGTGTGTGTGTGTTGAGG - Intronic
959783275 3:110262304-110262326 GAGTGTGTGTGTGTGTGTTGGGG - Intergenic
959837061 3:110931611-110931633 ATGTGTGTATGTGTGTGTTGGGG - Intergenic
959908457 3:111736122-111736144 ATGTGTGCATGTGTGTTTTGTGG - Intronic
960034299 3:113087042-113087064 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
960187769 3:114664600-114664622 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
960223150 3:115140539-115140561 GAGTGTGTATGTGTGTGTGGTGG + Intronic
960281279 3:115784156-115784178 GAGGGAGCGCGGGTGTGTTGGGG - Intergenic
960334310 3:116397392-116397414 GTGTGTGTATGTGTGTGTGGGGG - Intronic
960340161 3:116465129-116465151 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
960354975 3:116640438-116640460 ATGTGTGCATGTGTGTGTTTGGG - Intronic
960458586 3:117904106-117904128 GTGTGTGTGTGTGTGTGTTGTGG - Intergenic
960521987 3:118665542-118665564 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
960534408 3:118800831-118800853 GGGTGTGTATGTGTGTGTGGAGG - Intergenic
961080310 3:124021319-124021341 GTGTGTGTGTGTGTGTGTTGAGG + Intergenic
961214385 3:125148291-125148313 GTGTGGGCACCTATGTGTTGGGG + Intronic
961385913 3:126523549-126523571 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
961515520 3:127431340-127431362 GTGCGTGCACGTGTGTGTGCAGG + Intergenic
961519389 3:127457919-127457941 GCACGTGCATGTGTGTGTTGGGG - Intergenic
961792779 3:129388508-129388530 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
961868350 3:129970901-129970923 GTGTGTGTATGTGTGTATTGTGG + Intergenic
962216910 3:133530524-133530546 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
962318328 3:134372526-134372548 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
962357667 3:134708824-134708846 GAATGTGTCTGTGTGTGTTGTGG + Intronic
962481371 3:135801318-135801340 GACTGTGTAAGTGTGTGGTGAGG + Intergenic
962590243 3:136882573-136882595 GTGTGTGTGTGTGTGTGTTGAGG + Intronic
962690386 3:137890944-137890966 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
962847214 3:139283152-139283174 GTGTGTGTGTGTGTGTGTTGAGG - Intronic
962867866 3:139462554-139462576 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
962933974 3:140062408-140062430 AAGTATACACGTGTGTGATGTGG + Intronic
963116495 3:141734693-141734715 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
963284749 3:143423202-143423224 GTGTGTGTACGTGTGTGTGAGGG - Intronic
963287161 3:143444497-143444519 AGGTATGTACGTGTGTGTTGGGG - Intronic
963322873 3:143828560-143828582 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
964033659 3:152169062-152169084 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
964442332 3:156725182-156725204 GAGTGAGGATGTGAGTGTTGAGG - Intergenic
964527743 3:157632969-157632991 GTGTGTGTATGTGTGTGGTGGGG - Intronic
964663784 3:159150579-159150601 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
964809337 3:160646485-160646507 GTGTGTGGGTGTGTGTGTTGGGG - Intergenic
964835963 3:160939228-160939250 GAGTATGTACGTGTGTTTGGAGG - Intronic
965109530 3:164402571-164402593 GTGTGTGTCTGTGTGTGTTGGGG + Intergenic
965370476 3:167855943-167855965 GCGTGTGTGTGTGTGTGTTGGGG - Intergenic
965545689 3:169914184-169914206 AGCTGTGCATGTGTGTGTTGGGG + Intronic
966129386 3:176620040-176620062 GTGTGTGCGTGTGTGTGTTTGGG + Intergenic
966228139 3:177620178-177620200 GAATGTGCGCATGTGTGTTTAGG - Intergenic
966318080 3:178671109-178671131 GTGTTTGTACGTGTGTTTTGGGG - Intronic
966712551 3:182984605-182984627 GAGTGTGTGTGTATGTGTTGGGG - Intronic
966819853 3:183915765-183915787 GATTGTGGGTGTGTGTGTTGGGG - Intergenic
966857125 3:184202430-184202452 GTGTGTGCATGTGTGTGCAGTGG - Intronic
966912560 3:184567497-184567519 GTGTGTGTGTGTGTGTGTTGCGG + Intronic
966928204 3:184659171-184659193 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
967241253 3:187441687-187441709 GTGTGTGTGCGTGTGTGTAGGGG - Intergenic
967382089 3:188869924-188869946 AAATGTGTACGTGTGTGTTAGGG - Intronic
967415269 3:189210115-189210137 GTGTGTGTCTGTGTGTGTTGGGG + Intronic
967449534 3:189608165-189608187 GTGTGTGCATGTATGTGTTGGGG + Intergenic
967479786 3:189959896-189959918 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
967489700 3:190076166-190076188 GTGTGTGCATGTGTGTTTGGTGG - Intronic
967626351 3:191689289-191689311 GTGTATGCATGTGTGTCTTGAGG - Intergenic
967687484 3:192434493-192434515 GATTGTGCATGTGTGTGTGCAGG + Intronic
967700146 3:192582893-192582915 CAGTGTGCATGTTTGTGTTGAGG - Intronic
967748724 3:193088932-193088954 GTGTGTGCATGTGTGTGTGGGGG - Intergenic
968015313 3:195326527-195326549 GTGTGTCCGTGTGTGTGTTGTGG - Intronic
968107690 3:196014087-196014109 GAGTGTTGACTTGAGTGTTGTGG + Intergenic
968522725 4:1041331-1041353 GTGTGTGCATGTGTGTGTGTCGG + Intergenic
968605921 4:1535424-1535446 ATGTGTGCACGTGTGTGTGCTGG + Intergenic
968637754 4:1690803-1690825 GTGTGTGCATGTGTGTGGTGGGG - Intergenic
968891048 4:3368689-3368711 GGGGGTGCCTGTGTGTGTTGGGG + Intronic
968891053 4:3368708-3368730 GGGGGTGCCTGTGTGTGTTGGGG + Intronic
968891059 4:3368728-3368750 GGGGGTGCCTGTGTGTGTTGGGG + Intronic
969076167 4:4579382-4579404 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
969239914 4:5891161-5891183 GTGTGTGTATGTGTGTGTGGTGG - Intronic
969301417 4:6299482-6299504 GGGTGTGCACGTGTGTGTAGGGG + Intronic
969301432 4:6299573-6299595 GTGTGTGAATGTGTGTGTAGGGG + Intronic
969301444 4:6299645-6299667 GTGTGTGAATGTGTGTGTAGGGG + Intronic
969301452 4:6299693-6299715 GTGTGTGAATGTGTGTGTAGGGG + Intronic
969301465 4:6299770-6299792 GTGTGTGAATGTGTGTGTAGGGG + Intronic
969301497 4:6299965-6299987 GTGTGTGCACGTGTGTGTACGGG + Intronic
969437257 4:7195180-7195202 GTGTGTGTGTGTGTGTGTTGTGG + Intronic
969609310 4:8218130-8218152 GTGTGTGCACGTGTGTGTGTTGG + Intronic
969656132 4:8499530-8499552 GGGTGAGGTCGTGTGTGTTGGGG + Intergenic
969763529 4:9210209-9210231 GAGTGTGTTTGTGTGTGTGGGGG - Intergenic
969772421 4:9329465-9329487 GAGTGTGTTTGTGTGTGTGGGGG - Intronic
969773038 4:9334212-9334234 GAGTGTGTTTGTGTGTGTGGGGG - Intronic
969773653 4:9338957-9338979 GAGTGTGTTTGTGTGTGTGGGGG - Intronic
969774268 4:9343702-9343724 GAGTGTGTTTGTGTGTGTGGGGG - Intronic
969774883 4:9348447-9348469 GAGTGTGTTTGTGTGTGTGGGGG - Intronic
969775499 4:9353192-9353214 GAGTGTGTTTGTGTGTGTGGGGG - Intronic
969776113 4:9357937-9357959 GAGTGTGTTTGTGTGTGTGGGGG - Intronic
969777342 4:9367428-9367450 GAGTGTGTTTGTGTGTGTGGGGG - Intergenic
970050875 4:11913543-11913565 GTGTGTGCATGTGTGTGTGTGGG - Intergenic
970064473 4:12076162-12076184 GTGTGTGTGTGTGTGTGTTGTGG + Intergenic
970192599 4:13530057-13530079 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
970712962 4:18885739-18885761 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
971156254 4:24086383-24086405 CAGTGTTGAAGTGTGTGTTGAGG - Intergenic
971618680 4:28827693-28827715 GTGTGTGTAAGTGTGTGGTGAGG - Intergenic
971670714 4:29553206-29553228 GTGTGTGTGTGTGTGTGTTGTGG + Intergenic
971880964 4:32371242-32371264 GAGTGTATATATGTGTGTTGGGG - Intergenic
972171078 4:36346228-36346250 GTGTGTGCATGTGTCTGTGGGGG - Intergenic
972268598 4:37486776-37486798 GTGTGTGCATGTGTATGTTTTGG - Intronic
972351436 4:38239790-38239812 GAGTGTGCACACGTGTGTGAAGG + Intergenic
972406762 4:38753469-38753491 GTGTGTGTACGTGTATGTTTGGG - Intergenic
972562703 4:40242979-40243001 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
972873481 4:43329215-43329237 GTTTGTGTATGTGTGTGTTGGGG + Intergenic
972883611 4:43457204-43457226 GTGTGTGTGTGTGTGTGTTGTGG + Intergenic
973115775 4:46456625-46456647 GTGTGTGTATGTGTGTGTGGTGG - Intronic
973567091 4:52199486-52199508 GAGTGTGTGTGTGTGTGTGGGGG + Intergenic
973947837 4:55978022-55978044 GCATGTGCATGTGTGTGTTTAGG + Intronic
974413740 4:61577194-61577216 GTGTGTGCATGTGTGTGTTAGGG + Intronic
974540868 4:63233003-63233025 GTGTGTGCGTGTGTGTGTGGTGG - Intergenic
974571145 4:63650295-63650317 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
974598547 4:64045287-64045309 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
974622705 4:64381877-64381899 GCAAGTGCACGTGTGTGTGGGGG + Intronic
974716356 4:65672405-65672427 GTGTGTGTGTGTGTGTGTTGTGG - Intergenic
974867120 4:67594942-67594964 GTGTGTGCATGTGTGTGATTGGG + Intronic
975601784 4:76107943-76107965 GTGTGTGCATGTGTGTGTTGGGG + Intronic
975783283 4:77862004-77862026 GTGTGTGTGTGTGTGTGTTGTGG + Intergenic
975930377 4:79514468-79514490 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
975986906 4:80208536-80208558 GTGTGTGTGTGTGTGTGTTGCGG - Intergenic
975990936 4:80259379-80259401 GAGTGTGAGTGTGTGTGTGGGGG - Intergenic
976134726 4:81923367-81923389 CTGTGTGCATGTGTGTGTTTTGG - Intronic
976689761 4:87856095-87856117 GTGTGTGTGCATGTGTGTTGGGG - Intergenic
977236310 4:94511594-94511616 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
977665583 4:99643735-99643757 GTGTGTGTGTGTGTGTGTTGTGG - Intronic
977912293 4:102551380-102551402 GTGTGTGTGTGTGTGTGTTGAGG + Intronic
978360194 4:107923472-107923494 GTGTGTGTATGTGTGTGTAGGGG - Intergenic
978620165 4:110629490-110629512 GCGTGTGAAGGTGTGTGTCGCGG + Intronic
978969165 4:114781494-114781516 CAGTGTGAACGTGTCTGTTAAGG - Intergenic
978993516 4:115118969-115118991 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
979366864 4:119835905-119835927 GTGTGTGTGTGTGTGTGTTGAGG - Intergenic
979416825 4:120451785-120451807 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
979615109 4:122733372-122733394 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
979627495 4:122861751-122861773 GGGTATGTATGTGTGTGTTGTGG - Intronic
979725282 4:123953768-123953790 GAGTGACCACATGTGTGCTGGGG + Intergenic
979755713 4:124338219-124338241 GTGTGTGTGTGTGTGTGTTGTGG + Intergenic
980113595 4:128658317-128658339 GTGTGTGCGCGTGTGTGTGTTGG + Intergenic
980113597 4:128658319-128658341 GTGTGCGCGTGTGTGTGTTGGGG + Intergenic
980249254 4:130292884-130292906 GTGTGTGCGCGTGTGTGTGTGGG + Intergenic
980491860 4:133538504-133538526 GTGTGTGTATGTGTGTGTTTAGG + Intergenic
982037553 4:151361414-151361436 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
982291869 4:153789534-153789556 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
982425751 4:155257667-155257689 TTCTGTGCAAGTGTGTGTTGGGG + Intergenic
982493833 4:156065172-156065194 GTGTGTGTATGTGTGTGTTGGGG + Intergenic
982582265 4:157194097-157194119 AAGTGGGCATGTGTGTGTTCAGG - Intergenic
983518317 4:168679456-168679478 GAGTATGGACGTGTGTGGGGGGG + Intronic
983879638 4:172918539-172918561 GTCTGTGAATGTGTGTGTTGGGG - Intronic
984043364 4:174766016-174766038 GAGGGTGTAAGTGTGTGTAGAGG - Intronic
984121831 4:175754966-175754988 AATTGTGTGCGTGTGTGTTGTGG - Intronic
984136642 4:175948977-175948999 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
984538713 4:181010443-181010465 GTGTGTGTGTGTGTGTGTTGAGG - Intergenic
984603853 4:181760955-181760977 GTGTGTGTATGTGTGTGGTGGGG - Intergenic
984642909 4:182189729-182189751 GCGTGTGGGTGTGTGTGTTGGGG + Intronic
984782403 4:183537874-183537896 GTGTGTGTGTGTGTGTGTTGAGG + Intergenic
984867305 4:184292714-184292736 GAGTGTGTATGTGTGTGTGGAGG + Intergenic
985515988 5:344805-344827 GTGTGTGCGGGTGTGTGTGGGGG + Intronic
985515998 5:344900-344922 GCGTGTGCAGGTGTGTGTGGAGG + Intronic
985606504 5:861030-861052 GGGTGTGCAGGTGTGTATGGGGG - Intronic
985656896 5:1136984-1137006 GTGTGTGCACATGTGTGTCCTGG - Intergenic
985660431 5:1154350-1154372 GTGTGTGTGTGTGTGTGTTGCGG - Intergenic
985730525 5:1544880-1544902 GTGTGTGCAGGTGTGTGTGCAGG - Intergenic
985730556 5:1545135-1545157 GTGTGTGCAGGTGTGTGTGCAGG - Intergenic
985730564 5:1545213-1545235 GTGTGTGCAGGTGTGTTTGGAGG - Intergenic
985795716 5:1960478-1960500 ATGTGTGCACGTGCATGTTGAGG - Intergenic
985795728 5:1960717-1960739 GTGTGTGCATGTGTGTTTTGGGG - Intergenic
985795753 5:1961196-1961218 GTGTGTGCATGTGTGTGATCAGG - Intergenic
985795754 5:1961255-1961277 GTGTGCGCATGTGTGTGTTCAGG - Intergenic
985891953 5:2723077-2723099 GGGGATGCACCTGTGTGTTGTGG - Intergenic
986170342 5:5309786-5309808 GAGAGTGCATGTGTGGGTTTAGG + Intronic
986189597 5:5482771-5482793 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
986251299 5:6060846-6060868 GTGTGTGCACATGTGTGCGGGGG - Intergenic
986798991 5:11240407-11240429 GTGTGTGTCAGTGTGTGTTGTGG - Intronic
986799013 5:11240613-11240635 GTGTATGTACGTCTGTGTTGGGG - Intronic
986799071 5:11241033-11241055 GTGTGTGTGCATGTGTGTTGGGG - Intronic
986806174 5:11310957-11310979 GTGTGTGTATGTGTGGGTTGAGG - Intronic
986806272 5:11311576-11311598 GAGTATGTATGTGTGGGTTGAGG - Intronic
986994534 5:13592061-13592083 GTGTGTGTGTGTGTGTGTTGCGG - Intergenic
987335642 5:16895749-16895771 GTGTGTGTGTGTGTGTGTTGTGG - Intronic
987576983 5:19742379-19742401 GCGTGTGCATTTGTGTGTTTTGG - Intronic
987841673 5:23230669-23230691 GTGTGTGTGTGTGTGTGTTGTGG - Intergenic
987872283 5:23636443-23636465 GTGTGTGCATGTGTGTGTGTGGG + Intergenic
988054340 5:26074056-26074078 GTGTGTGCATGTGTGGGTTTGGG + Intergenic
988391670 5:30642142-30642164 GAGTGTGCAGGTATGGGATGGGG - Intergenic
988495445 5:31741754-31741776 GAGTATGCACGGGGGGGTTGGGG - Intronic
988565232 5:32315404-32315426 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
989033991 5:37150507-37150529 GTGTGCGCGCGTGTGTGTTGGGG - Intronic
989131353 5:38110260-38110282 GTGTGTGCGTGTGTGTGTTGAGG - Intergenic
989158946 5:38371595-38371617 GTGTGCGCATGTGTGTGTTTTGG - Intronic
989456997 5:41655469-41655491 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
989631509 5:43487318-43487340 GAGTGTGTATGTGTGTGTTTGGG + Intronic
989740504 5:44765679-44765701 GTGTGTGCACATGTGTGTATCGG - Intergenic
990016658 5:51071658-51071680 GTGTGTGTGTGTGTGTGTTGAGG + Intergenic
990254107 5:53947204-53947226 GTGTGTGTGTGTGTGTGTTGAGG + Intronic
990562634 5:56998027-56998049 GTGTGTACATGTGTGTATTGGGG - Intergenic
990978185 5:61577241-61577263 GTGTGTACCCATGTGTGTTGGGG + Intergenic
991255227 5:64606254-64606276 AAATGTGTACGTGTATGTTGTGG - Intronic
991459618 5:66844181-66844203 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
991471316 5:66971748-66971770 GCATGTGTATGTGTGTGTTGGGG + Intronic
991605494 5:68396520-68396542 GAGTGTGCACATGTGCATTGAGG + Intergenic
992409345 5:76489900-76489922 CAGTGTGCATATGTGTGGTGTGG - Intronic
992773683 5:80071641-80071663 GTGTGTGTATGTGTGTGTTGGGG - Intronic
993206267 5:84883486-84883508 GTGTATGTATGTGTGTGTTGGGG + Intergenic
993431280 5:87834704-87834726 GAGTGCACACGTGTGTTTAGTGG - Intergenic
993605662 5:89987887-89987909 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
993969574 5:94401603-94401625 GAGTGAGCCAGTGTGTGTTGAGG - Intronic
994260868 5:97657000-97657022 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
994690347 5:103011341-103011363 GTGTGTGTATGTGTGTGTGGCGG - Intronic
994709081 5:103244138-103244160 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
994710662 5:103259686-103259708 GTGTGTGCGCGTGTGGATTGGGG + Intronic
994799011 5:104345854-104345876 GAGTGTGAATGTGTGACTTGAGG - Intergenic
994939485 5:106303239-106303261 GAGTGTGTGTGTGTGTGTTTAGG + Intergenic
995130773 5:108628092-108628114 CAGTGTGTGTGTGTGTGTTGGGG + Intergenic
996145861 5:119975306-119975328 GTGTGTGTATGTGTGTGGTGTGG + Intergenic
996163660 5:120197994-120198016 ACGTGTGCATGTGTGTGTTTTGG - Intergenic
996200936 5:120672264-120672286 GTGTGTGTGTGTGTGTGTTGTGG + Intronic
996300268 5:121973598-121973620 GTGTGTGCATGTGTGTGTGGGGG + Intronic
996519413 5:124410242-124410264 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
996851756 5:127960796-127960818 GTGTGTGTGTGTGTGTGTTGTGG - Intergenic
997639737 5:135441426-135441448 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
997652587 5:135533612-135533634 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
997827172 5:137116761-137116783 CAGTGTGCATGTGTGTGTTGGGG - Intronic
997869830 5:137497843-137497865 GTGTGTGTGTGTGTGTGTTGAGG - Intronic
998406546 5:141877809-141877831 AAGTGTGTATGTATGTGTTGTGG + Intronic
998559971 5:143162270-143162292 GTGTGTGTATGTGTGTGTTTGGG - Intronic
998597033 5:143542495-143542517 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
998903896 5:146882965-146882987 GAGTGGGTATGTGAGTGTTGGGG - Intronic
999250004 5:150176884-150176906 CTGTTTGCATGTGTGTGTTGGGG + Intronic
999254704 5:150203847-150203869 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
999270942 5:150296066-150296088 TAGTGTGCATGTGTGTGTGTTGG - Intergenic
999270984 5:150296281-150296303 GTGTGTGCATGTGTGTCCTGGGG - Intergenic
999298787 5:150477461-150477483 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
999330750 5:150672013-150672035 GCGCGTGCGCGTGTGTGTTGGGG - Intronic
999379002 5:151106878-151106900 GAGTGTGAAATGGTGTGTTGTGG + Intronic
999601785 5:153274487-153274509 GTGTGTGTGCGTGTGTGTGGTGG - Intergenic
999651665 5:153774075-153774097 GAGTGTGTGTGTGTGTGTGGGGG - Intronic
999745317 5:154587481-154587503 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1000116030 5:158154175-158154197 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1000253187 5:159514381-159514403 GTGTGTGTGCGTGTGTGTTCTGG - Intergenic
1000346144 5:160315314-160315336 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1000760145 5:165213496-165213518 GTATGTGCACATGTGTGCTGGGG - Intergenic
1000895230 5:166847275-166847297 GTGTGTGCACGTGTGTGTTGGGG + Intergenic
1001001646 5:168013099-168013121 GTGTGTGTAAGTGTGTGTTGGGG - Intronic
1001022530 5:168195594-168195616 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1001118862 5:168962307-168962329 GTGTGTGTGTGTGTGTGTTGTGG - Intronic
1001245734 5:170104940-170104962 GTGCGTGTATGTGTGTGTTGGGG + Intergenic
1001300924 5:170533187-170533209 GAGTGTGTGTGTGTGTGTTGAGG + Intronic
1001705007 5:173735251-173735273 GAGTCAGCACGTGTGTGGTCTGG + Intergenic
1001709423 5:173766265-173766287 GAGTCTGCACGTGTGTCTCTGGG + Intergenic
1001774194 5:174316367-174316389 GTGTGTGTATGTGTGTGTGGTGG + Intergenic
1001833973 5:174814920-174814942 GTGTGTGTACGTGTGTGTGTGGG - Intergenic
1002167522 5:177357769-177357791 GTGTGTGCGCGTGTGTGTGTAGG + Intergenic
1002599921 5:180348267-180348289 GCGTGTGCACGTGTGTGCCTGGG + Intronic
1002668018 5:180840805-180840827 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1002775286 6:323246-323268 GTGTGTGTGTGTGTGTGTTGAGG + Intronic
1002840617 6:902270-902292 GTGTGTGTGCATGTGTGTTGAGG + Intergenic
1003038342 6:2664455-2664477 CAGTGTGCATGCGTGTGCTGGGG - Exonic
1003114690 6:3276111-3276133 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1003313095 6:4986412-4986434 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1003397571 6:5766234-5766256 GAGTGTGCCTGCGTGAGTTGGGG + Intronic
1003820908 6:9895939-9895961 GGCTGTGGATGTGTGTGTTGGGG - Intronic
1003840613 6:10115349-10115371 GTGTGTGTTTGTGTGTGTTGTGG - Intronic
1003874434 6:10423617-10423639 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1003917928 6:10805052-10805074 GTGTGTGCATGTGTGTGTCGGGG + Intronic
1003973273 6:11319334-11319356 GAGTGTGCATGTGAGTGTGTGGG - Intronic
1004084291 6:12429515-12429537 GTGTGTGCACATGTGTGTGTTGG + Intergenic
1004180108 6:13373737-13373759 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1004294014 6:14394006-14394028 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1004351960 6:14898005-14898027 GTGTGTGCGCGTGTGTGTGGTGG - Intergenic
1004673700 6:17821571-17821593 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1004845737 6:19639725-19639747 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1005181894 6:23115650-23115672 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1005199254 6:23324705-23324727 GTGTGTGTATGTGTGTGTTGGGG - Intergenic
1005430445 6:25751120-25751142 GGGTGTGCATGGGTGTGTAGGGG + Intergenic
1005485765 6:26297825-26297847 GAGTGTGTATGTGTGTGGTGGGG - Intergenic
1006110076 6:31739107-31739129 GTGTGTGTGTGTGTGTGTTGCGG - Intronic
1006173139 6:32106980-32107002 GTGTGTGCACGTGTGTGCATGGG - Intronic
1006208667 6:32374268-32374290 GTGTGTGTGTGTGTGTGTTGAGG + Intergenic
1006505830 6:34488054-34488076 GAGAGTGCAAGTGTCTGTTGTGG - Intronic
1006559697 6:34899985-34900007 GAGTGTGTATGTGTGTATTTGGG + Intronic
1006560301 6:34905443-34905465 GAGTGTGTATGTGTGTATTTGGG + Intronic
1006907407 6:37542130-37542152 GGGTGTGCCTGTGTGTATTGTGG + Intergenic
1006921967 6:37633178-37633200 GTGTGTGTGTGTGTGTGTTGGGG - Exonic
1006923088 6:37638943-37638965 GTGTGTGCATGTGTGTGTTTGGG - Intronic
1007077405 6:39076644-39076666 GAGTGTGCACGTATGACTTTGGG - Intronic
1007157449 6:39759182-39759204 CAGTGTGCATGTGTTTGTGGGGG + Intergenic
1007384260 6:41510047-41510069 GTGTGTGTACGTGTGTGTTGGGG - Intergenic
1007490351 6:42216396-42216418 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1007540806 6:42642303-42642325 ATGTGTGCATGTGTGTGATGTGG - Intronic
1007600576 6:43078257-43078279 GTGTGCGCGCGTGTGTGTGGGGG + Intronic
1007609886 6:43142503-43142525 GTGTGTGTGTGTGTGTGTTGTGG + Intronic
1007630648 6:43271432-43271454 GTGTATGCACATGTGTGTTAGGG + Intronic
1007769556 6:44181819-44181841 GAGTGTGTGTGTGTGTGGTGTGG - Intronic
1008725601 6:54414589-54414611 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1009668462 6:66713219-66713241 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1010120579 6:72371169-72371191 GTGTGTGCACATGTGTGGTCTGG + Intronic
1010279321 6:74005678-74005700 GTGTGTGTGTGTGTGTGTTGTGG + Intergenic
1010318808 6:74482941-74482963 GGGAGTGCATGCGTGTGTTGCGG - Intergenic
1010373742 6:75141745-75141767 GTGTGTGCATGTATGTGTAGTGG - Intronic
1010411172 6:75563345-75563367 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1010564110 6:77387715-77387737 AAGTGTGTCTGTGTGTGTTGGGG + Intergenic
1011021626 6:82819936-82819958 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1011172763 6:84524307-84524329 GCATGTGCACGTGTGTGATGGGG + Intergenic
1011499987 6:87977423-87977445 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1011534972 6:88366914-88366936 GAGTGTGTATGTGTGTGGGGAGG + Intergenic
1012109139 6:95204439-95204461 GAGTGTGTATGTGTGTGTGTTGG + Intergenic
1012209865 6:96506413-96506435 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1012687395 6:102268952-102268974 GTGTGTGTGTGTGTGTGTTGAGG - Intergenic
1012700858 6:102455182-102455204 GTGTGTGTATGTGTGTGTTTAGG + Intergenic
1012765126 6:103357797-103357819 GTGTGTGCAGGTGTTGGTTGTGG - Intergenic
1012930324 6:105309709-105309731 GAGTGTGCAAGAGTGTCTGGGGG - Intronic
1013072855 6:106744573-106744595 GTATGTGCATGTGTGTGTAGGGG + Intergenic
1013745441 6:113339918-113339940 GTGTGTGTGTGTGTGTGTTGTGG - Intergenic
1013786443 6:113786817-113786839 GTGTGTGCATGTGTGTGTGATGG + Intergenic
1014237349 6:118973247-118973269 GCGTCTGTATGTGTGTGTTGTGG + Intronic
1014313662 6:119836754-119836776 TTGTGTGTACGTGTGTGTTTAGG + Intergenic
1015067752 6:129051904-129051926 GAGTGTGTAGATGTGTGTTTAGG + Intronic
1015953179 6:138574433-138574455 GAGTGTGCACAGATGTGTGGCGG - Intronic
1016025754 6:139285253-139285275 GTGTGTGTGTGTGTGTGTTGAGG - Intronic
1016293485 6:142549481-142549503 GGGTGTGTGTGTGTGTGTTGTGG + Intergenic
1016688143 6:146904476-146904498 GTGTGTGTGTGTGTGTGTTGAGG + Intergenic
1016778488 6:147932622-147932644 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1017562389 6:155642807-155642829 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1017798504 6:157869848-157869870 GTGTGTGCGAGTGTGTGTGGGGG - Intronic
1017851897 6:158311398-158311420 GAGTGTTCTCGTGTTTGTAGAGG + Intronic
1017878596 6:158544201-158544223 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1018095708 6:160385561-160385583 CTGGGTGCAGGTGTGTGTTGAGG - Intronic
1018296948 6:162358146-162358168 GAAAGTGTATGTGTGTGTTGGGG + Intronic
1018302483 6:162418644-162418666 GTGTGTATGCGTGTGTGTTGAGG + Intronic
1018378837 6:163239675-163239697 GAGTGTGCGTGTGTGTGTAGGGG - Intronic
1018776516 6:167022255-167022277 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1019057497 6:169233832-169233854 GTGTGGGCAGTTGTGTGTTGTGG - Intronic
1019356637 7:583368-583390 GAGTGTGCACATGTGTGAGTGGG - Intronic
1019407792 7:892906-892928 GGGTGTGCAGGTGTGTGTACTGG + Intronic
1019408617 7:897136-897158 ACGTGTCCACGTGTGTGCTGAGG - Intergenic
1019553816 7:1618675-1618697 GTGTGTGTAGGTGTGTGTAGGGG + Intergenic
1019553871 7:1619022-1619044 GTGTGTGTAGGTGTGTGTAGGGG + Intergenic
1019553904 7:1619227-1619249 GGGTGTGTAGGTGTGTGTAGGGG + Intergenic
1019553913 7:1619283-1619305 GGGTGTGTAGGTGTGTGTAGGGG + Intergenic
1019630721 7:2047774-2047796 GAGTGTGCATGTGTCTGCAGAGG - Intronic
1019755132 7:2763187-2763209 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1020017127 7:4837626-4837648 GTGTGTGCATGTGTGTTTTTGGG - Intronic
1020953908 7:14715517-14715539 ATGTGTGCCTGTGTGTGTTGGGG - Intronic
1020968522 7:14903237-14903259 GTGTGTGTGTGTGTGTGTTGAGG + Exonic
1021085187 7:16414346-16414368 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1021293028 7:18869170-18869192 GTGTGTGTGTGTGTGTGTTGCGG + Intronic
1021446696 7:20741775-20741797 GTGTGTGCATGTGTGTGTGGTGG - Intronic
1021905159 7:25326257-25326279 GTGTGTGTGTGTGTGTGTTGAGG + Intergenic
1022230898 7:28410862-28410884 GCGATTGCACGAGTGTGTTGTGG - Intronic
1022234474 7:28447635-28447657 GTGTGTGTATGTGTGTATTGTGG + Intronic
1022335087 7:29414668-29414690 ACGTGTGCATGCGTGTGTTGGGG - Intronic
1022483678 7:30760980-30761002 GAGGGAACACCTGTGTGTTGCGG + Intronic
1022518721 7:30992140-30992162 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1022560230 7:31340361-31340383 GTGTGTATATGTGTGTGTTGAGG - Intronic
1022701221 7:32762117-32762139 GAGAGTGCACGTGTGGGCTTGGG - Intergenic
1022887654 7:34663075-34663097 GTGTGTGTATGTGTGTGTGGCGG + Intronic
1022977721 7:35574521-35574543 GTGTGTGTGTGTGTGTGTTGTGG - Intergenic
1023082058 7:36535180-36535202 CTGTGTGCCTGTGTGTGTTGTGG + Intronic
1023590446 7:41775566-41775588 GTGTGTGTGCGTGTGTCTTGAGG + Intergenic
1023731802 7:43198706-43198728 GAGTGTGCAAATCTGTATTGTGG - Intronic
1024148786 7:46545380-46545402 GAGTGTGCACGTGTGTGCATTGG - Intergenic
1024316695 7:48026577-48026599 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1024473668 7:49788852-49788874 GTGTGTGAGCGTGTGTGTGGGGG + Intronic
1024524843 7:50339241-50339263 GTGTGTGTGTGTGTGTGTTGTGG + Intronic
1024602676 7:50998334-50998356 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1024689281 7:51781600-51781622 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1025652540 7:63484072-63484094 GTGTGTGTAGGTGTGTGTGGGGG + Intergenic
1026890335 7:73977985-73978007 GTGTGTGCAAGTGTGTGTGCAGG + Intergenic
1027164712 7:75826136-75826158 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1027632903 7:80629782-80629804 GAGTGTTAAGGTGTATGTTGAGG - Intronic
1027861795 7:83593318-83593340 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1028487930 7:91380289-91380311 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1028493374 7:91438904-91438926 AAGAGTGCATGTGTGTGTTGTGG - Intergenic
1028649120 7:93130687-93130709 GTGTGTGTGTGTGTGTGTTGGGG + Exonic
1029043614 7:97603659-97603681 GTGTGTGCATGTGTGTATTGTGG + Intergenic
1030071573 7:105702541-105702563 GTGTGTGTGTGTGTGTGTTGTGG - Intronic
1030275775 7:107720107-107720129 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1030375714 7:108751067-108751089 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1030395472 7:108981030-108981052 GTGTGTGTATGTGTGTGTAGTGG - Intergenic
1030927274 7:115474492-115474514 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1031155979 7:118112884-118112906 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1031925602 7:127635323-127635345 GTGTGTGTGTGTGTGTGTTGAGG + Intergenic
1032023366 7:128422163-128422185 GTGTGTGTATGTGTGTGGTGTGG + Intergenic
1032023379 7:128422280-128422302 GTGTGTGTAAGTGTGTGTAGGGG + Intergenic
1032089673 7:128904983-128905005 GAGTGTGTGTGTGTGTGTTGGGG + Intronic
1032453509 7:132054403-132054425 GTGTGTGTAAGTGTGTGTGGAGG - Intergenic
1032566841 7:132955198-132955220 GTGTGTGTGTGTGTGTGTTGCGG + Intronic
1032960079 7:137022225-137022247 GTGTGTGTATGTGTGTGTTAAGG - Intergenic
1033491562 7:141848479-141848501 GTGTGTGTGTGTGTGTGTTGCGG + Intergenic
1033571201 7:142630449-142630471 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1033601318 7:142890921-142890943 TGGTGTGCATGTGTGTGTGGTGG - Intergenic
1033639330 7:143246051-143246073 GCGTGTGTGTGTGTGTGTTGAGG - Intronic
1033927271 7:146478673-146478695 GTGTGTGTACATGTGTGTAGAGG - Intronic
1034013126 7:147552567-147552589 GTGTGTGTGTGTGTGTGTTGAGG - Intronic
1034318629 7:150158863-150158885 CTGTGTGCACGTGTGTGTGTGGG - Intergenic
1034418922 7:150978887-150978909 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1034455185 7:151166483-151166505 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1034774123 7:153808337-153808359 GTGTTTGCACGTGTGTGTGTGGG + Intergenic
1034869547 7:154671849-154671871 GTGTGTGCATGTGTGTGTTGGGG - Intronic
1034984882 7:155504685-155504707 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1035094754 7:156344578-156344600 GAGTGTGAATGTGTGTGTGTCGG - Intergenic
1035116702 7:156530753-156530775 GTGTGTGCATTTGTGTGTTAAGG + Intergenic
1035226141 7:157433499-157433521 GTGTGTGCATGTGTGGGTGGGGG - Intergenic
1035243165 7:157545316-157545338 GGGTGTGTAGGTGTGTGTGGGGG + Intronic
1035368733 7:158364966-158364988 GTGTGTGAATGTGTGTGTTGTGG - Intronic
1035705596 8:1672055-1672077 TTGTGTGCATGTGTGTGTTTGGG + Intronic
1035813400 8:2512795-2512817 GGGTGTACACCTGTGTGATGGGG + Intergenic
1035877397 8:3206348-3206370 GTGTGTGTATGTGTGTATTGGGG + Intronic
1035877402 8:3206381-3206403 GTGTGTGTATGTGTGTGTGGGGG + Intronic
1035877409 8:3206443-3206465 GTGTGTGTATGTGTGTGTGGGGG + Intronic
1035979062 8:4348591-4348613 GTGTGTGCGTGGGTGTGTTGGGG + Intronic
1036018440 8:4814242-4814264 GTGTGTGTATGTGTGTGGTGGGG + Intronic
1036201532 8:6774715-6774737 GCGTGTGCACCTGTGTGCTGAGG - Intergenic
1036426225 8:8646860-8646882 GTGTGTGCTAGTGTGTGTTTGGG - Intergenic
1037172829 8:15913886-15913908 GTGTGTGCACGTGTGTCTAAAGG + Intergenic
1037431841 8:18821680-18821702 GTGTGTGTGTGTGTGTGTTGTGG - Intronic
1037590125 8:20304911-20304933 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1037745903 8:21643830-21643852 GCGCGTGCATGTGTGTGTTTTGG - Intergenic
1038557124 8:28530125-28530147 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1038729009 8:30110379-30110401 GCGTGCGCGCGTGTGTGTAGTGG + Intronic
1038908416 8:31934382-31934404 GTGTGTGTATGTGTGTGTAGGGG - Intronic
1039440287 8:37590497-37590519 GAGTGTGCATGGGTGTGTGTGGG - Intergenic
1039456522 8:37711005-37711027 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1039557743 8:38488730-38488752 GTGTGTGTGTGTGTGTGTTGTGG - Intergenic
1039796943 8:40923845-40923867 GAGTCTGCAGTTGTGTGGTGGGG - Intergenic
1039829682 8:41202838-41202860 GTGTGTGTATGTGTGTGTTTTGG - Intergenic
1040513674 8:48117315-48117337 GAATGTCCCAGTGTGTGTTGAGG + Intergenic
1040534811 8:48299543-48299565 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1040978281 8:53217888-53217910 GAGTGTGCGCGTGTGTGGGGGGG + Intergenic
1041015881 8:53592876-53592898 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1041261515 8:56024621-56024643 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1041372756 8:57180573-57180595 GTGTGTACACATGTGTGTTGGGG + Intergenic
1041864197 8:62550405-62550427 GCGTGTGCGCGTGTGTGTGGTGG + Intronic
1041990543 8:63985001-63985023 GTGTGTGTGCGTGTGTGTTGAGG + Intergenic
1042007887 8:64202790-64202812 GTGTGTGTACGTGTATGTTTTGG - Intergenic
1042334576 8:67616535-67616557 GTGTGTGTGTGTGTGTGTTGTGG + Intronic
1042456678 8:69013543-69013565 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1042702644 8:71633447-71633469 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1042722746 8:71843027-71843049 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1042757120 8:72227300-72227322 GAGTGTGCATGTGTGGGAAGTGG + Intergenic
1042962992 8:74321910-74321932 GTGCGGCCACGTGTGTGTTGAGG + Intronic
1043054125 8:75415759-75415781 GTGTGTGCACGTGTGTGTGTTGG + Intronic
1043389261 8:79776367-79776389 GTGTATGCACATGTGTGTGGGGG - Intergenic
1044037122 8:87320600-87320622 GTATGTGCACGTGTGTGTGTGGG + Intronic
1044080943 8:87882953-87882975 GGGAGTGCCTGTGTGTGTTGAGG - Intergenic
1044466666 8:92514446-92514468 GTGTGTGTGTGTGTGTGTTGTGG + Intergenic
1044603711 8:94031111-94031133 GAGTGGGTATGTGTGTGATGCGG + Intergenic
1044757482 8:95480111-95480133 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1045352903 8:101358821-101358843 GTGTGTGTATTTGTGTGTTGGGG - Intergenic
1045768898 8:105710695-105710717 GTGTGTGTATGTGTGTGTGGGGG + Intronic
1046010223 8:108537487-108537509 GTGTGTGCATGTGTGTGTGTGGG + Intergenic
1046530768 8:115442585-115442607 GTGTGTGCATGTGTGTGTTTGGG + Intronic
1046619197 8:116509934-116509956 GTGTATGCACGTGTGTGTGAGGG - Intergenic
1046717984 8:117587903-117587925 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1046993868 8:120493460-120493482 GTGTGTGTATGTGTGTGTGGGGG + Intronic
1047118788 8:121876575-121876597 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1047148987 8:122239823-122239845 GTGTGTGTGTGTGTGTGTTGTGG - Intergenic
1047158620 8:122350937-122350959 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1047224751 8:122946840-122946862 ACGTGTGAACATGTGTGTTGGGG - Intronic
1047468504 8:125143812-125143834 GTGTGTGTATGTGTGTGTTAGGG - Intronic
1047523588 8:125614502-125614524 GAGTGTGCAAGTGTGTGTGAGGG + Intergenic
1047870504 8:129077130-129077152 GAGTGTGGACATGTGTGTGTTGG + Intergenic
1047870506 8:129077132-129077154 GTGTGGACATGTGTGTGTTGGGG + Intergenic
1048060830 8:130917775-130917797 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1048254127 8:132892655-132892677 GTGTGTGTATGTGTGTGCTGTGG + Intronic
1048254142 8:132892825-132892847 GTGTGTGTATGTGTGTGGTGTGG + Intronic
1048293014 8:133194645-133194667 GCGTGTGTGCGTGTGTGGTGGGG + Intronic
1048307885 8:133296479-133296501 GAGTGTAAGCGTGTGTGTGGGGG - Intronic
1048501762 8:134983006-134983028 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1048531845 8:135257001-135257023 GTGTGTGTTTGTGTGTGTTGGGG + Intergenic
1048720942 8:137323802-137323824 GTGTGTGCGTGTGTGTGTTTGGG + Intergenic
1048865369 8:138757032-138757054 GTGTGTGCACGTGTGTGCAGGGG - Intronic
1048865394 8:138757310-138757332 GTGTGTGTATGTGTGTGTGGAGG + Intronic
1048936351 8:139360658-139360680 GAGTGTGCAGGAGTGGGTGGGGG - Intergenic
1048985144 8:139731075-139731097 CAGTGTGCACGTGTGTGCCCTGG - Exonic
1049032347 8:140047220-140047242 GTGCGTGCGCGTGTGTGATGTGG - Intronic
1049191872 8:141292751-141292773 GTGTATGCCTGTGTGTGTTGTGG - Intronic
1049398602 8:142413558-142413580 GTGTGTGCACGTGTGTGTGTGGG - Intergenic
1049452367 8:142669194-142669216 GTGTGTGCGTGTGTGTGTTGGGG + Intronic
1049637869 8:143698903-143698925 AAGTGTGCACGTGTGGGGAGGGG - Intronic
1049744079 8:144255758-144255780 GCGTGTGCACGCGCGTGGTGGGG + Intronic
1049754961 8:144306921-144306943 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1049826305 8:144670993-144671015 GTGTGAGCACATGTGTGTGGTGG - Intergenic
1050042078 9:1506611-1506633 GTGTGTGCACGTGTGTGGTGTGG + Intergenic
1050206029 9:3197107-3197129 GTGTGTGTGTGTGTGTGTTGTGG + Intergenic
1050551950 9:6756723-6756745 GAGTGTGTCTGTGTGTGTAGCGG + Intronic
1051550030 9:18317389-18317411 GTGTGTGTGTGTGTGTGTTGAGG - Intergenic
1051595313 9:18819052-18819074 TAGTGATCAGGTGTGTGTTGAGG - Intronic
1051779934 9:20679155-20679177 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1052105785 9:24513157-24513179 GAGTGGGATTGTGTGTGTTGTGG - Intergenic
1052132857 9:24870851-24870873 GTGTGTGTACGTGTGTGTGTTGG - Intergenic
1052243656 9:26306710-26306732 GTGTGCGTGCGTGTGTGTTGGGG - Intergenic
1052394934 9:27927523-27927545 GTGTGTGTGTGTGTGTGTTGTGG + Intergenic
1052554855 9:30000599-30000621 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1052768419 9:32665376-32665398 GAGGGTGTGTGTGTGTGTTGGGG + Intergenic
1052861698 9:33441724-33441746 GTGTGTGCATGTGTGTGCAGGGG - Exonic
1052883520 9:33621611-33621633 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1052953264 9:34231159-34231181 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1053284774 9:36843136-36843158 GTGTGTGCATGTGTGTGTGTAGG + Intronic
1053850864 9:42288389-42288411 CCGTGTGCACGTGTGTGTGTCGG - Intergenic
1053875097 9:42536357-42536379 GTGTGTGTATGTGTGTGTGGAGG - Intergenic
1053886812 9:42649955-42649977 GGGTGTGCAGGTGTGGGTGGGGG - Intergenic
1054225831 9:62457405-62457427 GGGTGTGCAGGTGTGGGTGGGGG - Intergenic
1054236600 9:62565362-62565384 GTGTGTGTATGTGTGTGTGGAGG + Intergenic
1054336470 9:63813856-63813878 GAGTGTGCTCCTGTGTCTGGCGG - Intergenic
1054573180 9:66831596-66831618 CCGTGTGCACGTGTGTGTGTCGG + Intergenic
1055128923 9:72752443-72752465 GTGTGTGTGTGTGTGTGTTGTGG - Intronic
1055134723 9:72814930-72814952 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1055589278 9:77793696-77793718 GCATGTGTATGTGTGTGTTGGGG - Intronic
1055839039 9:80480511-80480533 GTGTGTACATGTGTGTGGTGAGG + Intergenic
1056252715 9:84766644-84766666 GAGTGTGTGTATGTGTGTTGAGG - Intronic
1056537967 9:87547597-87547619 GTGTGTGTGCGTGTGTGTAGAGG + Intronic
1056541010 9:87571432-87571454 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1056541014 9:87571494-87571516 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1057404629 9:94757747-94757769 GTGTGAGCATGTGTGTGTTCAGG + Intronic
1057714855 9:97484465-97484487 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1057741349 9:97714662-97714684 GGGTGTGCATTTGTGTATTGGGG + Intergenic
1057819310 9:98318897-98318919 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1057828005 9:98385961-98385983 GAGTGAGCACCTGGGTGTTGGGG - Intronic
1057907521 9:98994094-98994116 TTGTGTGTAAGTGTGTGTTGGGG + Intronic
1057930976 9:99192737-99192759 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1057950819 9:99367957-99367979 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1058375194 9:104314811-104314833 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1058873281 9:109220745-109220767 GTGTGTGCACGTGCGTGTGTTGG + Intronic
1058902696 9:109456146-109456168 AGGTGTGCGTGTGTGTGTTGGGG + Intronic
1058983970 9:110195070-110195092 GTGTGTGCATGTGTGTGTGGAGG - Intronic
1059280946 9:113133559-113133581 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1059319856 9:113461221-113461243 GTGTGTGCACATGTGTGAGGTGG + Intronic
1059332075 9:113542011-113542033 GTGTGTGCACGTGTGTGTGTTGG - Intronic
1059415065 9:114157071-114157093 GTGTGTGTGTGTGTGTGTTGTGG - Intronic
1059652712 9:116330605-116330627 GTGTGTGCGTGTGTGTGTAGGGG + Intronic
1060084805 9:120688126-120688148 GTGTGTGTGTGTGTGTGTTGCGG - Intronic
1060110643 9:120904242-120904264 GGGTGTGCTCCTGCGTGTTGGGG + Exonic
1060203435 9:121666863-121666885 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1060508148 9:124213859-124213881 TAGTGTGGACGTATGTGTTCGGG + Intergenic
1060816335 9:126637456-126637478 GCGTGTGCATTTGTGTGTGGGGG + Intronic
1060887978 9:127168919-127168941 GCGTGTGCTTGTGTGTGCTGGGG - Intronic
1061083525 9:128386155-128386177 GGGTGTGCCTGTGTGTGTGGAGG - Intronic
1061209747 9:129184093-129184115 GAGTGTGTGTGTGTGTGTGGTGG + Intergenic
1061247447 9:129407989-129408011 GTGTGTGTGTGTGTGTGTTGAGG - Intergenic
1061904806 9:133691165-133691187 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1061917765 9:133764162-133764184 GTGTGTGCATGTCTATGTTGGGG + Intronic
1061951263 9:133937463-133937485 GAGTGTGAACATGTGTGGGGTGG + Intronic
1062022457 9:134326051-134326073 GTGTGTGCGCGAGTGTGTGGCGG + Intronic
1062197981 9:135285156-135285178 GCGTGTGCACGTGTGTGCCTGGG - Intergenic
1062198083 9:135285717-135285739 GCGTGTGCACGTGTGTGCCTGGG - Intergenic
1062198177 9:135286217-135286239 GTGTGTGCACGTGTGTGCCTGGG - Intergenic
1062198185 9:135286280-135286302 GTGTGTGCACGTGTGTGCCTGGG - Intergenic
1062198211 9:135286464-135286486 GTGTGTGCACGTGTGTGCCTGGG - Intergenic
1062253893 9:135611993-135612015 GAGTGTGCACGTGTGTGTGCAGG - Intergenic
1062294608 9:135817727-135817749 AGGTGTGCACGTGTGGGGTGGGG + Intronic
1062325558 9:136010915-136010937 GTGTGTGCAGGGGTGTGGTGAGG - Exonic
1062328445 9:136023958-136023980 GCATGTGCACGTGTGTGTGGGGG - Intronic
1062444160 9:136586469-136586491 GTGTGTGCCCGTGTGTGTAGAGG + Intergenic
1185480175 X:440136-440158 GTGTGTGCACCTGTGTGTGTGGG - Intergenic
1185480190 X:440363-440385 GTGTGTGCACCTGTGTGTGGGGG - Intergenic
1185589754 X:1267451-1267473 GTGTGTGCAGGTGTGTGTGCAGG + Intergenic
1185589770 X:1267704-1267726 GTGTGTGCAGGTGTGTGTGCAGG + Intergenic
1185589800 X:1268225-1268247 GTGTGTGCAGGTGTGTGTGCAGG + Intergenic
1185764344 X:2712864-2712886 TTGTGTGCACGTGTGTGTATGGG - Intronic
1185816546 X:3161485-3161507 GAGTATGCTTGTGTGTGGTGAGG - Intergenic
1186015724 X:5191068-5191090 GTGTGTGTGCGTGTGTGTGGTGG - Intergenic
1186084169 X:5968491-5968513 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1186861570 X:13677660-13677682 GTATGTGCGCGTGTGTGTGGGGG + Intronic
1186872540 X:13786594-13786616 GACTCTGAACGTGTGTGTCGGGG - Intronic
1187291550 X:17959073-17959095 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1187308922 X:18122241-18122263 GTGTGTGTATGTGTGTGTTGAGG - Intergenic
1187678621 X:21743402-21743424 GTGTGTGCACGTGTGTGTGGTGG - Intronic
1187821051 X:23288546-23288568 GTGTATATACGTGTGTGTTGAGG - Intergenic
1187955067 X:24509485-24509507 GTATGTGTATGTGTGTGTTGGGG - Intronic
1188003319 X:25001907-25001929 GTGTGTGTGTGTGTGTGTTGTGG - Intergenic
1188231791 X:27673042-27673064 GTGTGTGTATGTGTGTGGTGGGG - Intronic
1188394594 X:29665222-29665244 GAGTGTGCATATGTGTGTATAGG + Intronic
1188536114 X:31198885-31198907 GTGTGTGCATGTATGTGTTTTGG + Intronic
1188581860 X:31723619-31723641 GTGTGTGTGTGTGTGTGTTGTGG - Intronic
1189090279 X:38074901-38074923 GTGTGTGTGTGTGTGTGTTGAGG - Intronic
1189132495 X:38514753-38514775 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1189193830 X:39134966-39134988 GAGTTACCAGGTGTGTGTTGAGG - Intergenic
1189241709 X:39529675-39529697 GTGTGTGCGTGTGTGTGGTGGGG - Intergenic
1189241711 X:39529677-39529699 GTGTGTGTGCGTGTGTGTGGTGG - Intergenic
1189348505 X:40260247-40260269 GTGTATGTGCGTGTGTGTTGAGG + Intergenic
1189549230 X:42076029-42076051 GTGTGTGTATGTGTGTGTGGGGG + Intergenic
1189645272 X:43121554-43121576 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1190103446 X:47541052-47541074 GAGGGTGGATGTGTGTGTGGGGG + Intergenic
1190222354 X:48520593-48520615 GTGTGTGTGTGTGTGTGTTGAGG - Exonic
1190339120 X:49282477-49282499 GTGTGTGTGTGTGTGTGTTGTGG + Intronic
1190643713 X:52505324-52505346 GAGTGTGCGAGTGTTTGTTATGG - Intergenic
1191054459 X:56227870-56227892 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1191058582 X:56270343-56270365 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1191717129 X:64201444-64201466 GTGTGTGTGTGTGTGTGTTGGGG - Intronic
1191999171 X:67129602-67129624 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1192157805 X:68759339-68759361 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1192193794 X:69015451-69015473 GTGTGAGCACATGTGTGTAGTGG + Intergenic
1192238004 X:69308146-69308168 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1192588680 X:72341278-72341300 TAGTGTGCACGTATGTGTCAGGG + Intronic
1192798472 X:74443991-74444013 GTGTGTGCATGTGTGTCTGGGGG + Intronic
1193080367 X:77400397-77400419 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1193125285 X:77864239-77864261 GAGTGTATGTGTGTGTGTTGTGG + Intronic
1193150799 X:78122435-78122457 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1194277691 X:91907366-91907388 GTGTGTGTGTGTGTGTGTTGAGG - Intronic
1194553644 X:95331561-95331583 TAGTGTCCTTGTGTGTGTTGGGG + Intergenic
1194598695 X:95892557-95892579 GTGTGTGTATGTGTGTGTTGGGG + Intergenic
1194657514 X:96590720-96590742 GTGTGTGCAAGTGTGTGTATGGG + Intergenic
1195045974 X:101054895-101054917 GTGTGTGTGTGTGTGTGTTGTGG - Intergenic
1195069570 X:101266345-101266367 ATGTGTGCATGTGTATGTTGGGG + Intergenic
1195133421 X:101877693-101877715 GTGTGTGTGTGTGTGTGTTGAGG - Intergenic
1195273728 X:103257808-103257830 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1195603839 X:106779373-106779395 GTGTGTGTGTGTGTGTGTTGAGG + Intronic
1195660727 X:107375246-107375268 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1196117882 X:112016711-112016733 ATGTGTGCATGTGTGTGTAGAGG + Intronic
1196322874 X:114363414-114363436 GTGTGTGTCTGTGTGTGTTGTGG + Intergenic
1196618013 X:117789835-117789857 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1196831400 X:119778598-119778620 GTGTGTGTGTGTGTGTGTTGTGG + Intergenic
1197288318 X:124623342-124623364 GTGTGTGCATGAGTGTGTTTGGG + Intronic
1197329820 X:125139819-125139841 GTGTGTGTGTGTGTGTGTTGAGG - Intergenic
1197630079 X:128848338-128848360 GTGTGTGTGTGTGTGTGTTGGGG + Intergenic
1197845345 X:130795985-130796007 GTGTGTGTATGTGTGTGTTCTGG + Intronic
1198080829 X:133237670-133237692 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1198130225 X:133686764-133686786 GTGTGTGTGTGTGTGTGTTGAGG - Intronic
1198217544 X:134569792-134569814 GTGTGTGTGTGTGTGTGTTGGGG + Intronic
1198285221 X:135183138-135183160 GTGTGTGTGTGTGTGTGTTGTGG - Intergenic
1198531553 X:137553384-137553406 GTGTGTGTGTGTGTGTGTTGTGG + Intergenic
1198783628 X:140263442-140263464 GGGTGTGTATGTGTGTGTTTTGG + Intergenic
1199030865 X:142998176-142998198 GTGTGTGTGTGTGTGTGTTGAGG + Intergenic
1199574334 X:149298838-149298860 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1199726228 X:150585097-150585119 GTGTGTGTATGTGTGTGTGGGGG + Intronic
1200058471 X:153473581-153473603 GTGTGTGCGTGTGTGTGTTTTGG + Intronic
1200595033 Y:5129434-5129456 GTGTGTGTGTGTGTGTGTTGAGG - Intronic
1201531722 Y:14997207-14997229 GTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1201728247 Y:17178696-17178718 GTGTGTGCCTGTGTGTATTGGGG - Intergenic