ID: 946865974

View in Genome Browser
Species Human (GRCh38)
Location 2:224040938-224040960
Sequence GGGAACAATTCAAAGGAGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 320
Summary {0: 1, 1: 0, 2: 3, 3: 39, 4: 277}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946865965_946865974 4 Left 946865965 2:224040911-224040933 CCAGTCAGGGCGGTGTGGGCTGG 0: 1
1: 0
2: 1
3: 40
4: 470
Right 946865974 2:224040938-224040960 GGGAACAATTCAAAGGAGGGGGG 0: 1
1: 0
2: 3
3: 39
4: 277

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946865974 Original CRISPR GGGAACAATTCAAAGGAGGG GGG Intergenic
900735907 1:4299441-4299463 GGGCACAATCCAAGGGAGGTAGG - Intergenic
902336326 1:15757012-15757034 GGGAAGGACTCAAAGGAGGAAGG - Intronic
902392486 1:16114713-16114735 GGGAACAGTGCTGAGGAGGGTGG + Intergenic
903396423 1:23005056-23005078 CGGAACAACTCAAAGCAGGGAGG - Intergenic
904036309 1:27561061-27561083 GGGGACAGATCAGAGGAGGGAGG - Intronic
905328271 1:37173961-37173983 AGGAAGAATTCAAGAGAGGGAGG + Intergenic
906562774 1:46771411-46771433 CAGGACAATTCAAAGCAGGGAGG - Intronic
906636856 1:47415972-47415994 GGGAATGATCCAAAGGAGAGGGG + Intergenic
907266985 1:53268056-53268078 GAGACTAATTCAAAGCAGGGTGG + Intronic
908989673 1:70071283-70071305 GGGAACAAGTCACAGCATGGTGG - Intronic
910880284 1:91916989-91917011 TGGAACAACTCAAAGCAGGGGGG + Intergenic
911945428 1:104101291-104101313 GGGAAGACTTCAAAGAAGAGGGG + Intergenic
911966504 1:104378700-104378722 TGGGACAATTCAAAGCAGGTAGG - Intergenic
912313302 1:108644710-108644732 GGGGACAACTCAAAGCAAGGAGG - Intronic
912445143 1:109730058-109730080 GGGGACAACTCAAAGCAGGGGGG + Intronic
915101690 1:153505675-153505697 GGTAGCAATCCAAAGGAGAGAGG + Intergenic
915961097 1:160267462-160267484 GGGAAAAAAGGAAAGGAGGGAGG - Intergenic
916424513 1:164668129-164668151 GGGAACAGATGACAGGAGGGTGG - Intronic
918005237 1:180535602-180535624 TGGGACAACTCAAAGCAGGGAGG + Intergenic
918967385 1:191369278-191369300 GGGAACAAAGGAAAGCAGGGGGG - Intergenic
919810905 1:201408303-201408325 GGAAACAATTGGGAGGAGGGTGG + Exonic
920000697 1:202796671-202796693 GGGCACATTTCTAAGGAGAGTGG - Intronic
921317313 1:213904997-213905019 GGGAAAAATGAAAAGCAGGGAGG + Intergenic
922666454 1:227473734-227473756 GAGAGCAAGCCAAAGGAGGGTGG + Intergenic
923464215 1:234233738-234233760 GCGAACAATGTAAAAGAGGGAGG + Intronic
924945480 1:248843562-248843584 TGGAACATTTGAAAGGAGGCTGG - Intronic
1064160336 10:12939941-12939963 GGGAATAGTTCAAAGGTCGGAGG + Intronic
1064929680 10:20611103-20611125 GGGAACAATGGAAAAGATGGAGG - Intergenic
1066054276 10:31665971-31665993 TGGGACAACTCAAAGCAGGGAGG + Intergenic
1066102905 10:32133674-32133696 GGGGACAACTCAAAGCAGGGAGG - Intergenic
1067183537 10:44008008-44008030 GGGAGCATTTCAAAGGTGGAAGG + Intergenic
1067958282 10:50818073-50818095 GGGATAAATTCAAAGGACGCAGG - Intronic
1068522202 10:58089904-58089926 GCTAGCAATGCAAAGGAGGGGGG - Intergenic
1068698187 10:59991753-59991775 GGGAACCACTCAAGGTAGGGAGG - Intergenic
1069077656 10:64054999-64055021 GGCAACTATTCAATGGGGGGGGG - Intergenic
1069241119 10:66140286-66140308 GGAAAGAATTGAAAGGAGGAGGG - Intronic
1070531176 10:77338708-77338730 TGGATCTCTTCAAAGGAGGGAGG + Intronic
1071930672 10:90466179-90466201 GGGAAGAATTCCCAGGAGGAAGG - Intergenic
1073238774 10:102039757-102039779 TAAAACAATTGAAAGGAGGGAGG - Intronic
1074233272 10:111559016-111559038 GGGCAGAATCCAAAGGAGGTTGG - Intergenic
1074728623 10:116343440-116343462 GGGAATCATTCCCAGGAGGGAGG - Intronic
1074776328 10:116770705-116770727 GGGAACAGTGCACAGGAGGTTGG - Intergenic
1076568580 10:131415875-131415897 GAGAAGAAATGAAAGGAGGGTGG - Intergenic
1079595915 11:22246315-22246337 GGGAAAAATGTAAAGTAGGGTGG - Intronic
1081788853 11:45768423-45768445 GTGAACCATGCAAGGGAGGGAGG + Intergenic
1083642780 11:64154347-64154369 GGGATCAATCCAAAAGAGGATGG - Intronic
1084879178 11:72158100-72158122 TGGGACAATTCAAAGTGGGGTGG - Intergenic
1084962778 11:72726055-72726077 GGAAACAGTTCTGAGGAGGGAGG + Intronic
1085418605 11:76336728-76336750 GGGAATGACTGAAAGGAGGGAGG + Intergenic
1085984735 11:81771899-81771921 GGGATGAATTCAATGAAGGGTGG + Intergenic
1090415048 11:126534883-126534905 GGGAACAATAAAGGGGAGGGGGG + Intronic
1090605009 11:128412676-128412698 GGGAAAAAATCAAAGAAGGGTGG + Intergenic
1090753423 11:129767021-129767043 GGAACCAATTGAAAGGAGGAGGG - Intergenic
1090880484 11:130828050-130828072 GGGGGCATTGCAAAGGAGGGAGG + Intergenic
1090981182 11:131724052-131724074 CAGAACAAGTCAGAGGAGGGAGG + Intronic
1091671760 12:2457119-2457141 AGGAACAAGTCAAAGAGGGGGGG + Intronic
1091993978 12:4978461-4978483 GGTAAGACTTCAAAGGAAGGGGG + Intergenic
1095746052 12:45660281-45660303 GGGAAAAATTGAAATGAGGCTGG + Intergenic
1095897583 12:47295600-47295622 AGGGACAACTCAAAGCAGGGAGG + Intergenic
1096311545 12:50525403-50525425 GGGCACAATTTAAAAGAGGGTGG + Intronic
1097744789 12:63289299-63289321 GGGAACTACTGAAAGGAGGGAGG - Intergenic
1097765875 12:63526038-63526060 GGGCACAATTAAAAGGACTGTGG - Intergenic
1097860282 12:64512035-64512057 GGGAAGAAGAGAAAGGAGGGGGG + Intergenic
1097945089 12:65358717-65358739 GGGAAAAAGTCAAAGCAGAGAGG - Intronic
1098197517 12:68017468-68017490 GGGAACAAGTGAAAGGATTGGGG + Intergenic
1099628962 12:85115585-85115607 GGGAACAATTCTAGGGAATGTGG - Intronic
1100121421 12:91373379-91373401 AGGGACAATTCAAAGTGGGGAGG - Intergenic
1100500770 12:95172022-95172044 GGGAACAATTCTAAGGGGGGGGG + Intronic
1101252792 12:102951765-102951787 GGGGACAATTTAAAGGGGAGGGG - Intronic
1106573068 13:30947556-30947578 GGGAATAACTCAAAGAATGGAGG - Intronic
1106849594 13:33775299-33775321 GGGAAGAAAAAAAAGGAGGGGGG - Intergenic
1107297485 13:38926159-38926181 GGGAACAGCTCAAAGGCGGGGGG - Intergenic
1107362761 13:39637845-39637867 GGGAACAAGGGAAAGCAGGGGGG - Intergenic
1107977748 13:45706173-45706195 GGGGACAATTGAAAGAAGGGAGG - Intronic
1109765919 13:66897228-66897250 GGGAAGAAAGGAAAGGAGGGAGG + Intronic
1110124831 13:71929771-71929793 GGGGACAACTCGAAGTAGGGAGG + Intergenic
1110239312 13:73249189-73249211 GGGAACAGCTCCAAGGAGGTAGG + Intergenic
1110410453 13:75199004-75199026 GGAAAGAATTAATAGGAGGGAGG + Intergenic
1113626414 13:111851217-111851239 GGGGACAACTCAAAGCAGGGAGG - Intergenic
1114264409 14:21064158-21064180 GGGAATAATTCAAAGTGCGGAGG + Intronic
1114352299 14:21866447-21866469 GGAAACAATACGAAGGAGGAAGG - Intergenic
1114401864 14:22417508-22417530 GGGAATACTGAAAAGGAGGGTGG + Intergenic
1114426349 14:22626851-22626873 CGGGACAACTCAAAGCAGGGAGG - Intergenic
1114441422 14:22751426-22751448 TGGAACAACTCAAAGGAGGGAGG + Intergenic
1117539979 14:56737658-56737680 GGGGAAAAGTCAAAGGTGGGGGG - Intergenic
1117857675 14:60051967-60051989 GGGAACAAAGAAAAGCAGGGTGG - Intronic
1120389971 14:83893969-83893991 AGGGACAACTCAAAGAAGGGAGG - Intergenic
1122953582 14:105059608-105059630 GGGGACAACTCGAAGCAGGGAGG - Intronic
1124251569 15:28109555-28109577 GGAAAGAATAAAAAGGAGGGAGG + Intergenic
1124870497 15:33536795-33536817 GGCAAGCATCCAAAGGAGGGAGG - Intronic
1126317920 15:47390527-47390549 GTGAGCAATTCAAATGGGGGTGG - Intronic
1126946181 15:53823067-53823089 TGGGACAACTCAAAGCAGGGAGG + Intergenic
1127652650 15:61024175-61024197 GGGAACAAGTCAAACTGGGGTGG + Intronic
1128297754 15:66539181-66539203 GGTAACCATTTAAAGGAGTGAGG - Intronic
1128766367 15:70253464-70253486 GGAAACTTTTCACAGGAGGGAGG + Intergenic
1129277311 15:74454742-74454764 GGGAAAAATTTAAAGAAGTGAGG + Intronic
1130032205 15:80326458-80326480 GGGAAGAATTCAAAGAACAGAGG - Intergenic
1131240449 15:90737551-90737573 GGGAACACTTTAAAGGACAGAGG + Intronic
1131328055 15:91468175-91468197 ATGAACTATTTAAAGGAGGGTGG - Intergenic
1131716655 15:95118875-95118897 GTGAGCATTTCAAAGGAGAGAGG - Intergenic
1132481745 16:169720-169742 AGGGAGATTTCAAAGGAGGGTGG - Intergenic
1132482611 16:173977-173999 AGGGAGATTTCAAAGGAGGGTGG - Intergenic
1134236153 16:12468060-12468082 GGGGACAAGTGAAAGGAGGCTGG - Intronic
1134339856 16:13335019-13335041 GGAAACAATTCACAGGAGGAAGG - Intergenic
1134831587 16:17328033-17328055 GCAATTAATTCAAAGGAGGGAGG - Intronic
1136450735 16:30353118-30353140 GGGAACAACTGACAGGAGTGGGG + Intronic
1137402985 16:48168380-48168402 GGGAAAATTTCAGAGGAGGTAGG - Intronic
1138815787 16:60201216-60201238 GGAGACAACTCAAAGCAGGGAGG - Intergenic
1139367505 16:66442384-66442406 GGGAACAGATCTAAGGAAGGAGG + Intronic
1141860884 16:86715365-86715387 GGGGACACTGTAAAGGAGGGGGG + Intergenic
1142482324 17:226690-226712 GGTGACATTTCAATGGAGGGAGG - Intronic
1143979371 17:10854911-10854933 GGGGACTATTCATAGGAGGTGGG + Intergenic
1145994213 17:29096321-29096343 GGTAATGATACAAAGGAGGGGGG - Intronic
1147588972 17:41669069-41669091 GGGTACAATTCAAAATAGGGAGG + Intergenic
1150002023 17:61446876-61446898 GGGAAGAATGCAAAGGAGAAAGG + Intergenic
1150564299 17:66325049-66325071 GGGAAGAATTAAAAGAAGTGGGG - Intronic
1151132889 17:71916486-71916508 TGGAACAATTCAAAGGTTGGGGG - Intergenic
1153415833 18:4844908-4844930 CGGAACAACTCAAAGCAGGGGGG - Intergenic
1154407973 18:14113391-14113413 TGGGACAACTCAAAGCAGGGAGG - Intronic
1155323779 18:24645602-24645624 GGGTACAAATGAAGGGAGGGTGG + Intergenic
1155736357 18:29227197-29227219 TGGGACAACTCAAAGGAGAGTGG - Intergenic
1156585673 18:38428346-38428368 TGGGACAACTCAAAGGAGGTAGG + Intergenic
1156755628 18:40521258-40521280 GGGAAGAAAGGAAAGGAGGGTGG - Intergenic
1156903459 18:42327712-42327734 GGGAACAACTCAAAGCAAGAAGG - Intergenic
1157484289 18:48075999-48076021 AGGAACAAGTTAAGGGAGGGTGG - Intronic
1158409477 18:57192727-57192749 GGGAACAAAGGAAAGGAGAGAGG + Intergenic
1159604666 18:70462657-70462679 GGAAACAATTCTTGGGAGGGGGG - Intergenic
1159918219 18:74204443-74204465 AGGGACAACTCAAAGTAGGGAGG - Intergenic
1161115339 19:2493734-2493756 GGGAACAGGTCAACGGAGGTCGG - Intergenic
1163088063 19:14997254-14997276 TGGAACAACTCAAAGTAGGGAGG - Intronic
1165344935 19:35239378-35239400 GGGAAGGATTCAAAGAAGTGGGG + Intergenic
1167200659 19:48062987-48063009 TGGGACAACTCAAAGCAGGGAGG + Intronic
1167750493 19:51376630-51376652 GGGGACAACTCAAAGCAGGGAGG - Intergenic
1168613362 19:57818556-57818578 GGGGACAACTCCAAGCAGGGAGG + Intronic
1168625916 19:57917778-57917800 GGGAACAACTCGAAGCAGGGAGG - Intergenic
925511872 2:4636811-4636833 GGGAACAACATGAAGGAGGGAGG - Intergenic
927676751 2:25111800-25111822 GGGCACAAGCCAAAGGATGGAGG + Intronic
928738250 2:34318602-34318624 GGGAAGAATTCAAAGGGGATTGG - Intergenic
929478800 2:42281888-42281910 GGGAATAATTCAAGGGACGTGGG - Intronic
930783409 2:55246650-55246672 GGGAAGAATGGAAGGGAGGGAGG + Intronic
931407399 2:61992902-61992924 GTAAACAATTAAAATGAGGGAGG + Intronic
931862722 2:66373254-66373276 GGGAACAATGGAGAGGAGGAAGG - Intergenic
932160843 2:69458168-69458190 GTGAACAAGAGAAAGGAGGGGGG - Intronic
932987183 2:76740171-76740193 GGGGACAACTTAAAGCAGGGAGG + Intergenic
933542914 2:83671265-83671287 GGGAACAAAAGAAAGGAGGGAGG + Intergenic
933600134 2:84320470-84320492 GGGAAGACTTCAAAGGAAGGTGG - Intergenic
936863344 2:117048271-117048293 GGGAAGAAGTCAAAGGAAAGGGG - Intergenic
937842103 2:126534432-126534454 AGGAACAAGAGAAAGGAGGGTGG + Intergenic
939881194 2:147633188-147633210 AGGAATAATTCAAGGGAGAGAGG - Intergenic
940895488 2:159078663-159078685 GGTAACAATTTAATGGATGGAGG - Intronic
940973743 2:159921467-159921489 AGGGACAACTCAAAGCAGGGTGG - Intergenic
940992730 2:160114499-160114521 GTGAAAAATACAAAGCAGGGGGG + Intronic
941429111 2:165390097-165390119 GGAACCAATTTAAAGGGGGGAGG + Exonic
941690989 2:168500583-168500605 GGGGACAATTACAAGGAGGTGGG + Intronic
942172627 2:173302769-173302791 TGGGACAATTCAAAGCAGGGTGG + Intergenic
942582194 2:177430642-177430664 GAGAACAAAGAAAAGGAGGGTGG - Intronic
943540507 2:189208174-189208196 GGTAACTAGGCAAAGGAGGGTGG - Intergenic
945350407 2:208771941-208771963 AAGGACAATTCAAAGGAGAGCGG + Intronic
946865974 2:224040938-224040960 GGGAACAATTCAAAGGAGGGGGG + Intergenic
947287376 2:228531630-228531652 TGGGACAACTCAAAGCAGGGAGG - Intergenic
948966698 2:241387246-241387268 GGGAAGAAAGAAAAGGAGGGAGG + Intronic
949076582 2:242062904-242062926 GGGGACAACTCGAAGCAGGGAGG + Intergenic
1169507433 20:6227038-6227060 AAGAACAATTCCAAGGAGAGGGG - Intergenic
1169813824 20:9635565-9635587 GGGATATATTCAAAGGAAGGAGG - Intronic
1171783600 20:29443245-29443267 GAGAACAATTTCAAGGAGGTGGG + Intergenic
1171905623 20:30897060-30897082 GGGAAGAATTCAAATGAGCATGG + Intergenic
1173013491 20:39203950-39203972 GGGAGCAATTGAAAGGGGGAAGG - Intergenic
1173788510 20:45812605-45812627 GGTTACAATTCAAACGCGGGCGG + Exonic
1177229669 21:18303382-18303404 AGGAAAAATTAAAGGGAGGGAGG + Intronic
1177526109 21:22292511-22292533 GGAAACTATTCAAAGGTGGGTGG + Intergenic
1178984464 21:37291037-37291059 GAGAACAATTAAAAGTATGGGGG + Intergenic
1179033490 21:37740503-37740525 CGGGACAACTCAAAGGAGGGGGG - Intronic
1179086526 21:38223085-38223107 GGGGACAACTCAAAGCAGGGAGG + Intronic
1179280599 21:39930877-39930899 GTGAACTATTCAGAGGATGGAGG - Intergenic
1181046053 22:20214840-20214862 GGGCACAACTCATAGGAGGCAGG + Intergenic
1181304803 22:21909592-21909614 TGGGACAACTCAAAGGTGGGGGG - Intergenic
1181952347 22:26563632-26563654 TGGAACAATTAAGAAGAGGGAGG - Intronic
1182442352 22:30371832-30371854 GGGAACCAGCCACAGGAGGGTGG + Intronic
1184420340 22:44378452-44378474 GGGAAAGATTGAAAGGAGAGAGG - Intergenic
1185317257 22:50184571-50184593 GGGAACCATTTAGAAGAGGGAGG - Intergenic
950401578 3:12773169-12773191 GGGAAGAAGTAAAGGGAGGGAGG + Intergenic
952166645 3:30756949-30756971 GGGGACATGTCAAAGGAGAGGGG + Intronic
953427374 3:42805895-42805917 GGGGACAACTCAAAGGCGAGAGG + Intronic
955047626 3:55374933-55374955 GGGCAGAATGCAAAGGTGGGGGG - Intergenic
956708713 3:72021897-72021919 CGGGACAATTCAAAGGACAGGGG - Intergenic
957983497 3:87542794-87542816 CAGAACAACTCAAAGCAGGGAGG + Intergenic
958023297 3:88021928-88021950 GGGACCAACTCAAAGCAGGGAGG + Intergenic
958171554 3:89945734-89945756 GGGAAGAATTCATTGGAGGAAGG + Intergenic
960006186 3:112783563-112783585 CGGGACAACTCAAAGCAGGGAGG - Intronic
962446935 3:135474231-135474253 AGGAAAATTTCAAAGGAGGAGGG - Intergenic
964074535 3:152677200-152677222 GGGAACAATACAAAGGAGGATGG + Intergenic
964219594 3:154328140-154328162 TGGGACAACTCAAAGGAGGAGGG - Intergenic
965364541 3:167782704-167782726 GCCAAGATTTCAAAGGAGGGAGG + Intronic
965487962 3:169301895-169301917 GGGGGCAACACAAAGGAGGGGGG + Intronic
966059887 3:175741953-175741975 CGGGACCACTCAAAGGAGGGAGG + Intronic
966253190 3:177889669-177889691 GGGAAGCAGTCAGAGGAGGGAGG + Intergenic
969294880 4:6263933-6263955 GGGAACACTGGGAAGGAGGGAGG + Intergenic
970422974 4:15922160-15922182 GGGGACAACTCAAAGCAGGGAGG + Intergenic
971687020 4:29784027-29784049 GGTAACAATTCAAAATAGGCAGG - Intergenic
971693254 4:29865184-29865206 AAGAACAATTCGAAGCAGGGAGG - Intergenic
973653182 4:53017787-53017809 AGGAACAATACCCAGGAGGGTGG - Intronic
974499501 4:62682000-62682022 GGGAAAAATACAAAGGAGTTAGG - Intergenic
976011246 4:80492133-80492155 TGGAACAACTCAAAGTCGGGAGG - Intronic
976746699 4:88410261-88410283 CGGGACAACTCAAAGCAGGGAGG + Intronic
977633058 4:99264108-99264130 GGGGACAAGCCAAAGCAGGGTGG - Intergenic
978701574 4:111652939-111652961 GGGGACAACTCAAAGCAGGGAGG + Intergenic
981577661 4:146222228-146222250 GTGAACAATTCATTAGAGGGGGG - Intergenic
981581318 4:146251232-146251254 TGGACCAATTTAAAGGAGTGAGG - Intergenic
982297928 4:153849047-153849069 GAGAACAAGTCTAAGAAGGGAGG - Intergenic
982759304 4:159261835-159261857 AGGAACAATTCATAGGTGAGTGG - Intronic
983896507 4:173086858-173086880 GGGACCAATTCTCAGGAAGGTGG + Intergenic
984166093 4:176304689-176304711 GGAGACAATTCGAAGCAGGGAGG - Intergenic
984254465 4:177374646-177374668 GGGAAGAAAGGAAAGGAGGGAGG - Intergenic
988017335 5:25575880-25575902 TGGGACAACTCAAAGCAGGGGGG - Intergenic
989204351 5:38796743-38796765 TGGAAAAAGTCAAAGAAGGGTGG - Intergenic
989319692 5:40120575-40120597 TGGGACAATTCAAAGCAGAGAGG - Intergenic
990907846 5:60822827-60822849 GGGAAAAATTCTGAAGAGGGAGG + Intronic
992197462 5:74354191-74354213 GGGAACAATTGAAATGCTGGAGG - Intergenic
993767857 5:91884105-91884127 GGGAATAATTAAAATGAGTGTGG + Intergenic
994272569 5:97798268-97798290 GGGAACAATGCAAAGGGGGAGGG + Intergenic
997577903 5:134997073-134997095 GGGCACGATTCAAGGCAGGGGGG - Intronic
998778788 5:145633076-145633098 GGCAACAACTCAAGGGAGTGTGG + Intronic
1000335690 5:160239570-160239592 GGTAACACTTCCAAGGAGAGAGG - Intergenic
1000403271 5:160855849-160855871 AAGAACAATTCAATGGAGGAAGG - Intergenic
1002767185 6:252167-252189 CTGAACAATTCTAAGGAGGAAGG - Intergenic
1002877860 6:1227061-1227083 GGGTGCAATTCAAAGGAGATGGG + Intergenic
1003195147 6:3907761-3907783 CGGAACAACTCAAAGTGGGGAGG - Intergenic
1004749438 6:18546487-18546509 ATGAACAATTGAAAGGAGAGTGG + Intergenic
1006494553 6:34412743-34412765 GTGAACAATACGAAGGTGGGAGG - Intronic
1007056087 6:38886290-38886312 GGTAACATTTCCAAGGAGGGGGG + Intronic
1007822624 6:44571846-44571868 GGGAATAAGACAAAGGTGGGTGG + Intergenic
1008028583 6:46667167-46667189 GTGAACAATTTAAAGGACAGAGG - Intronic
1008380277 6:50833387-50833409 GGGACCAATACTAAGGAGAGAGG + Intronic
1009777425 6:68222588-68222610 GGGAAGAATGGAAAGCAGGGTGG + Intergenic
1011657178 6:89562538-89562560 GGGAACAATTCACAGATCGGAGG - Exonic
1012825241 6:104139319-104139341 GGGGACAACTCGAAGCAGGGAGG - Intergenic
1013151820 6:107453474-107453496 AAAAACAATTCAATGGAGGGAGG - Intronic
1013226547 6:108123039-108123061 GGGAAGAATTCAAAGTCAGGAGG + Intronic
1014113302 6:117645454-117645476 GAGGACAAGCCAAAGGAGGGTGG + Intergenic
1015910484 6:138163876-138163898 GAAAACAAGTCAAAGAAGGGAGG + Intronic
1018242894 6:161795526-161795548 GAAAACAATACAAAGGAGGCTGG - Intronic
1019126192 6:169841543-169841565 TGGGACAACTCAAAGCAGGGAGG + Intergenic
1019878191 7:3834600-3834622 GGGAGCAAATGAAAGGACGGTGG - Intronic
1021222855 7:17993234-17993256 GGAAATATTTCAAAGGAGAGTGG - Intergenic
1021784142 7:24135609-24135631 GGGGACATTTCAAAAGAGGAAGG + Intergenic
1022640581 7:32178683-32178705 AGGAACAAGTCAAAGGAGAGAGG - Intronic
1023938067 7:44753932-44753954 GAGAGCAATTCAAAGGAGGAAGG - Intronic
1024547704 7:50536260-50536282 TGGGACAATTCAAAGCAGGGAGG - Intronic
1025083784 7:56006212-56006234 GGGAAGAAGTAAAAGGAGAGAGG + Intergenic
1027052702 7:75029859-75029881 GGGGCCCATTCAAAGGAGGCCGG + Intronic
1028927425 7:96373822-96373844 GGGAACATTTCAAATGAAGGAGG - Intergenic
1029931249 7:104373671-104373693 GGGAAAAACTCAAAGGCAGGTGG + Intronic
1031727393 7:125258127-125258149 GGGGACAACTCACAGCAGGGAGG + Intergenic
1032705726 7:134419881-134419903 GGGAACAATTAAAAGCAGGTAGG - Intergenic
1033122135 7:138675725-138675747 GGTAAAAATACATAGGAGGGAGG - Intronic
1033282330 7:140015206-140015228 GGGGACCATCCACAGGAGGGAGG + Intronic
1033610384 7:142958961-142958983 TGGAACAACTCAAAGGGGTGGGG - Intronic
1034083722 7:148304222-148304244 AGGAACACATCAAAGAAGGGAGG + Intronic
1034918220 7:155058360-155058382 GGGGACAACTCGAAGCAGGGAGG + Intergenic
1035864338 8:3066098-3066120 AAGGACAATTCAAAGGAGTGCGG + Intronic
1036462096 8:8962299-8962321 GGGGAGAATGCAGAGGAGGGAGG + Intergenic
1036809468 8:11857705-11857727 GGGAACCATGAAAAGGAGGGCGG - Intronic
1038009655 8:23464940-23464962 GGGGACAACTCAAAGCAAGGAGG + Intergenic
1038105822 8:24432688-24432710 GGGGACAACTCGAAGCAGGGAGG + Intergenic
1038149705 8:24931376-24931398 CAGAACAACTCAAAGCAGGGAGG - Intergenic
1038175981 8:25182691-25182713 GAGAAAAATCCAAAGCAGGGAGG - Intergenic
1038205812 8:25463920-25463942 GGGAAGATGTCACAGGAGGGAGG - Intronic
1038341081 8:26685403-26685425 GGAAACAAGTAAAAAGAGGGTGG - Intergenic
1038898115 8:31810593-31810615 AGAAACAATTAAAGGGAGGGAGG - Intronic
1038932021 8:32203909-32203931 GAGAAAAATTCAAAGGAAAGAGG + Intronic
1039863918 8:41484332-41484354 AGGTACAATTCTAAGGAGGGAGG + Intergenic
1042208013 8:66348429-66348451 GGGAGAAACTCAAAGGAGAGAGG - Intergenic
1042821687 8:72936648-72936670 GAAAGCAATTAAAAGGAGGGAGG + Exonic
1043959445 8:86399897-86399919 GGCAACAAGGGAAAGGAGGGTGG + Intronic
1044836179 8:96297762-96297784 AGGAGCATTTCAAAGGAGAGTGG - Intronic
1045399382 8:101797006-101797028 GGGGATAACTCAAAGTAGGGAGG - Intronic
1045588930 8:103571325-103571347 GGGAACAATGCAAATGTGGCTGG - Intronic
1046555513 8:115768549-115768571 GGGAAGAAGTGAAGGGAGGGAGG - Intronic
1047125155 8:121951769-121951791 GGGGACAACTCGAAGCAGGGAGG - Intergenic
1047955027 8:129967752-129967774 GCAAAATATTCAAAGGAGGGTGG - Intronic
1047996753 8:130343773-130343795 GGGAGCAACTTAAGGGAGGGAGG + Intronic
1049405025 8:142448570-142448592 GTCATCAAGTCAAAGGAGGGCGG + Intergenic
1049456201 8:142690977-142690999 TGGGACAACTCAAAGCAGGGAGG + Intergenic
1050845392 9:10210502-10210524 GGAAAGAATGCCAAGGAGGGGGG + Intronic
1052873695 9:33535018-33535040 TTGAAAAATTCAAAGGAGGAAGG - Intronic
1053365677 9:37520979-37521001 GGGCCCAGTTCAAAGGAGGAAGG + Intronic
1053502396 9:38609745-38609767 TTGAAAAATTCAAAGGAGGAAGG + Intergenic
1055162004 9:73141878-73141900 GGGGACAACTCAAAGCAGGGAGG - Intergenic
1055462801 9:76535054-76535076 AGGGACAACTCAAAGCAGGGAGG - Intergenic
1055617051 9:78083749-78083771 GAGGACAAGCCAAAGGAGGGCGG + Intergenic
1057153695 9:92819877-92819899 TTGAAAAATTCAAAGGAGGAAGG - Intergenic
1057348792 9:94277102-94277124 CGGGACAACTCAAAGTAGGGGGG + Intronic
1057681797 9:97194184-97194206 TTGAAAAATTCAAAGGAGGAAGG + Intergenic
1058245236 9:102615174-102615196 CGGGACAAATCAAAGCAGGGAGG - Intergenic
1059248358 9:112867010-112867032 GGGAGGAATTCTGAGGAGGGGGG - Intronic
1059248436 9:112867329-112867351 GGGAAGAGTTCTGAGGAGGGAGG - Intronic
1059248445 9:112867369-112867391 GGGAAGAGTTCTGAGGAGGGAGG - Intronic
1060314497 9:122496698-122496720 TGGGACAACTCAAAGCAGGGAGG + Intergenic
1061671466 9:132190880-132190902 GGCTAGAAGTCAAAGGAGGGTGG - Intronic
1186020807 X:5253009-5253031 GGGGACAACTCAAAGCAGGGAGG - Intergenic
1186050808 X:5592950-5592972 TGGGACAACTCAAAGCAGGGAGG - Intergenic
1186421792 X:9432641-9432663 GAGAACCATTCAAAGAAGCGAGG + Intergenic
1186779698 X:12900259-12900281 GGGGACAACTCGAAGCAGGGAGG - Intergenic
1186871880 X:13781683-13781705 GGGGACAACTCGAAGCAGGGAGG - Intronic
1190332936 X:49247122-49247144 GGGAACCATGCAAAGGTGTGGGG + Intronic
1190616671 X:52240703-52240725 GGGAACACTTCAGAGAACGGAGG - Intergenic
1191776582 X:64821303-64821325 GGAAAGAATTCTAAGGAGGACGG + Intergenic
1192788463 X:74355973-74355995 GGGAACAATTCAATGAAGTCAGG + Intergenic
1194396914 X:93397426-93397448 AGGAAAAATTAAAAGGAGGCTGG + Intergenic
1194442499 X:93950265-93950287 AGGGACAACTCAAAGCAGGGAGG + Intergenic
1197275585 X:124475302-124475324 GGGAATAAATCAAAGCATGGAGG - Intronic
1198258491 X:134945881-134945903 TGGGACAACTCAAAGCAGGGAGG - Intergenic
1199150890 X:144485619-144485641 CAGAACAACTCAAAGCAGGGAGG - Intergenic
1199329291 X:146540316-146540338 GGCAACAATTCAAAGAATGGAGG - Intergenic
1199383029 X:147192677-147192699 TGGGACAACTCAAAGTAGGGAGG + Intergenic
1199385220 X:147215683-147215705 TGGGACAATTCAAAGTAGGGAGG + Intergenic
1200326189 X:155242174-155242196 GGGAACTGTTAAAAAGAGGGTGG - Intergenic
1200417348 Y:2926243-2926265 AGGGACAACTCAAAGCAGGGAGG - Intronic
1201253871 Y:12088242-12088264 AGGAAAAAATGAAAGGAGGGAGG - Intergenic
1201490814 Y:14539580-14539602 GGAAACAAGTTAGAGGAGGGAGG - Intronic