ID: 946867401

View in Genome Browser
Species Human (GRCh38)
Location 2:224054734-224054756
Sequence GCACCACACTGCTTCCCACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946867401_946867406 5 Left 946867401 2:224054734-224054756 CCATGTGGGAAGCAGTGTGGTGC No data
Right 946867406 2:224054762-224054784 AGGAACCTGAAGAAGATCTATGG No data
946867401_946867407 6 Left 946867401 2:224054734-224054756 CCATGTGGGAAGCAGTGTGGTGC No data
Right 946867407 2:224054763-224054785 GGAACCTGAAGAAGATCTATGGG No data
946867401_946867409 11 Left 946867401 2:224054734-224054756 CCATGTGGGAAGCAGTGTGGTGC No data
Right 946867409 2:224054768-224054790 CTGAAGAAGATCTATGGGACAGG No data
946867401_946867410 14 Left 946867401 2:224054734-224054756 CCATGTGGGAAGCAGTGTGGTGC No data
Right 946867410 2:224054771-224054793 AAGAAGATCTATGGGACAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946867401 Original CRISPR GCACCACACTGCTTCCCACA TGG (reversed) Intergenic
No off target data available for this crispr