ID: 946867404

View in Genome Browser
Species Human (GRCh38)
Location 2:224054756-224054778
Sequence ATCTTCTTCAGGTTCCTCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946867404_946867411 9 Left 946867404 2:224054756-224054778 CCCTGGAGGAACCTGAAGAAGAT No data
Right 946867411 2:224054788-224054810 AGGAGGAGAAAGACAGAGAGAGG No data
946867404_946867410 -8 Left 946867404 2:224054756-224054778 CCCTGGAGGAACCTGAAGAAGAT No data
Right 946867410 2:224054771-224054793 AAGAAGATCTATGGGACAGGAGG No data
946867404_946867412 14 Left 946867404 2:224054756-224054778 CCCTGGAGGAACCTGAAGAAGAT No data
Right 946867412 2:224054793-224054815 GAGAAAGACAGAGAGAGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946867404 Original CRISPR ATCTTCTTCAGGTTCCTCCA GGG (reversed) Intergenic
No off target data available for this crispr