ID: 946867405

View in Genome Browser
Species Human (GRCh38)
Location 2:224054757-224054779
Sequence GATCTTCTTCAGGTTCCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946867405_946867410 -9 Left 946867405 2:224054757-224054779 CCTGGAGGAACCTGAAGAAGATC No data
Right 946867410 2:224054771-224054793 AAGAAGATCTATGGGACAGGAGG No data
946867405_946867412 13 Left 946867405 2:224054757-224054779 CCTGGAGGAACCTGAAGAAGATC No data
Right 946867412 2:224054793-224054815 GAGAAAGACAGAGAGAGGAGTGG No data
946867405_946867411 8 Left 946867405 2:224054757-224054779 CCTGGAGGAACCTGAAGAAGATC No data
Right 946867411 2:224054788-224054810 AGGAGGAGAAAGACAGAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946867405 Original CRISPR GATCTTCTTCAGGTTCCTCC AGG (reversed) Intergenic
No off target data available for this crispr