ID: 946867410

View in Genome Browser
Species Human (GRCh38)
Location 2:224054771-224054793
Sequence AAGAAGATCTATGGGACAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946867401_946867410 14 Left 946867401 2:224054734-224054756 CCATGTGGGAAGCAGTGTGGTGC No data
Right 946867410 2:224054771-224054793 AAGAAGATCTATGGGACAGGAGG No data
946867404_946867410 -8 Left 946867404 2:224054756-224054778 CCCTGGAGGAACCTGAAGAAGAT No data
Right 946867410 2:224054771-224054793 AAGAAGATCTATGGGACAGGAGG No data
946867405_946867410 -9 Left 946867405 2:224054757-224054779 CCTGGAGGAACCTGAAGAAGATC No data
Right 946867410 2:224054771-224054793 AAGAAGATCTATGGGACAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946867410 Original CRISPR AAGAAGATCTATGGGACAGG AGG Intergenic
No off target data available for this crispr