ID: 946867924

View in Genome Browser
Species Human (GRCh38)
Location 2:224059186-224059208
Sequence CAGTATAGATGCTGAGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946867921_946867924 -5 Left 946867921 2:224059168-224059190 CCTCAATAAGCAAACATCCAGTA No data
Right 946867924 2:224059186-224059208 CAGTATAGATGCTGAGAAGTGGG No data
946867919_946867924 23 Left 946867919 2:224059140-224059162 CCTGGGGCAGAGGCAAGGGGAGA No data
Right 946867924 2:224059186-224059208 CAGTATAGATGCTGAGAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946867924 Original CRISPR CAGTATAGATGCTGAGAAGT GGG Intergenic
No off target data available for this crispr