ID: 946868967

View in Genome Browser
Species Human (GRCh38)
Location 2:224068759-224068781
Sequence CCACAGGCATAGCCTTTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946868960_946868967 26 Left 946868960 2:224068710-224068732 CCGGAACTCTCTGAAGAGAGCCA No data
Right 946868967 2:224068759-224068781 CCACAGGCATAGCCTTTGCCAGG No data
946868961_946868967 6 Left 946868961 2:224068730-224068752 CCAAAGTAGATCTTCTCCACCCT No data
Right 946868967 2:224068759-224068781 CCACAGGCATAGCCTTTGCCAGG No data
946868963_946868967 -10 Left 946868963 2:224068746-224068768 CCACCCTGACATACCACAGGCAT No data
Right 946868967 2:224068759-224068781 CCACAGGCATAGCCTTTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946868967 Original CRISPR CCACAGGCATAGCCTTTGCC AGG Intergenic
No off target data available for this crispr