ID: 946870256

View in Genome Browser
Species Human (GRCh38)
Location 2:224078525-224078547
Sequence TCCGCCCCATGTCACATAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946870253_946870256 15 Left 946870253 2:224078487-224078509 CCATTTTATTCATCTCTAGTTCA No data
Right 946870256 2:224078525-224078547 TCCGCCCCATGTCACATAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946870256 Original CRISPR TCCGCCCCATGTCACATAGA TGG Intergenic
No off target data available for this crispr