ID: 946873788

View in Genome Browser
Species Human (GRCh38)
Location 2:224108319-224108341
Sequence GGAAGTTCACGTGTTTGCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946873788_946873793 12 Left 946873788 2:224108319-224108341 CCTCTGCAAACACGTGAACTTCC No data
Right 946873793 2:224108354-224108376 CTGTCCTCCCAGTGCTCAGGTGG No data
946873788_946873794 13 Left 946873788 2:224108319-224108341 CCTCTGCAAACACGTGAACTTCC No data
Right 946873794 2:224108355-224108377 TGTCCTCCCAGTGCTCAGGTGGG No data
946873788_946873792 9 Left 946873788 2:224108319-224108341 CCTCTGCAAACACGTGAACTTCC No data
Right 946873792 2:224108351-224108373 ACTCTGTCCTCCCAGTGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946873788 Original CRISPR GGAAGTTCACGTGTTTGCAG AGG (reversed) Intergenic
No off target data available for this crispr