ID: 946876842

View in Genome Browser
Species Human (GRCh38)
Location 2:224138004-224138026
Sequence GAGGGCAAAGAGAAGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946876842_946876850 5 Left 946876842 2:224138004-224138026 CCCTCTTCCTTCTCTTTGCCCTC No data
Right 946876850 2:224138032-224138054 CCAGCCACCAAGCTGTGTATGGG No data
946876842_946876853 21 Left 946876842 2:224138004-224138026 CCCTCTTCCTTCTCTTTGCCCTC No data
Right 946876853 2:224138048-224138070 GTATGGGTTGTCCCTGCACAAGG No data
946876842_946876848 4 Left 946876842 2:224138004-224138026 CCCTCTTCCTTCTCTTTGCCCTC No data
Right 946876848 2:224138031-224138053 TCCAGCCACCAAGCTGTGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946876842 Original CRISPR GAGGGCAAAGAGAAGGAAGA GGG (reversed) Intergenic
No off target data available for this crispr