ID: 946878718

View in Genome Browser
Species Human (GRCh38)
Location 2:224156718-224156740
Sequence TTCCCTTGACAACCCCAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946878718_946878720 26 Left 946878718 2:224156718-224156740 CCTCTTTGGGGTTGTCAAGGGAA No data
Right 946878720 2:224156767-224156789 TTTTATGACAAATTGTCCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946878718 Original CRISPR TTCCCTTGACAACCCCAAAG AGG (reversed) Intergenic
No off target data available for this crispr