ID: 946878881

View in Genome Browser
Species Human (GRCh38)
Location 2:224158058-224158080
Sequence ATGATACGTACTTTCAAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946878881_946878884 16 Left 946878881 2:224158058-224158080 CCAGCCTTGAAAGTACGTATCAT No data
Right 946878884 2:224158097-224158119 TCTAATCACACAGACCAACTTGG No data
946878881_946878885 17 Left 946878881 2:224158058-224158080 CCAGCCTTGAAAGTACGTATCAT No data
Right 946878885 2:224158098-224158120 CTAATCACACAGACCAACTTGGG No data
946878881_946878887 28 Left 946878881 2:224158058-224158080 CCAGCCTTGAAAGTACGTATCAT No data
Right 946878887 2:224158109-224158131 GACCAACTTGGGTATGATATGGG No data
946878881_946878886 27 Left 946878881 2:224158058-224158080 CCAGCCTTGAAAGTACGTATCAT No data
Right 946878886 2:224158108-224158130 AGACCAACTTGGGTATGATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946878881 Original CRISPR ATGATACGTACTTTCAAGGC TGG (reversed) Intergenic
No off target data available for this crispr