ID: 946880866

View in Genome Browser
Species Human (GRCh38)
Location 2:224176021-224176043
Sequence AGAGTTAAGAAGGGTGTGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946880863_946880866 -1 Left 946880863 2:224175999-224176021 CCTAGCTGAAGCATCACAAAGAA No data
Right 946880866 2:224176021-224176043 AGAGTTAAGAAGGGTGTGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946880866 Original CRISPR AGAGTTAAGAAGGGTGTGTT TGG Intergenic
No off target data available for this crispr