ID: 946881924

View in Genome Browser
Species Human (GRCh38)
Location 2:224185154-224185176
Sequence CTGAATGCTGAAACCAAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946881917_946881924 29 Left 946881917 2:224185102-224185124 CCCTGGGTACTGTCTAGGAGGAA No data
Right 946881924 2:224185154-224185176 CTGAATGCTGAAACCAAGGGAGG No data
946881921_946881924 -1 Left 946881921 2:224185132-224185154 CCACTATCACAAGCAGGCTGCAC No data
Right 946881924 2:224185154-224185176 CTGAATGCTGAAACCAAGGGAGG No data
946881918_946881924 28 Left 946881918 2:224185103-224185125 CCTGGGTACTGTCTAGGAGGAAG No data
Right 946881924 2:224185154-224185176 CTGAATGCTGAAACCAAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946881924 Original CRISPR CTGAATGCTGAAACCAAGGG AGG Intergenic
No off target data available for this crispr