ID: 946882058

View in Genome Browser
Species Human (GRCh38)
Location 2:224186184-224186206
Sequence GCCCTTTCGGATAGAACCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946882058_946882068 30 Left 946882058 2:224186184-224186206 CCTGGGGTTCTATCCGAAAGGGC No data
Right 946882068 2:224186237-224186259 TGCAGGATGGTGAGAGGAAGGGG No data
946882058_946882063 13 Left 946882058 2:224186184-224186206 CCTGGGGTTCTATCCGAAAGGGC No data
Right 946882063 2:224186220-224186242 AGAGAGGAAAGAAATTATGCAGG No data
946882058_946882067 29 Left 946882058 2:224186184-224186206 CCTGGGGTTCTATCCGAAAGGGC No data
Right 946882067 2:224186236-224186258 ATGCAGGATGGTGAGAGGAAGGG No data
946882058_946882064 17 Left 946882058 2:224186184-224186206 CCTGGGGTTCTATCCGAAAGGGC No data
Right 946882064 2:224186224-224186246 AGGAAAGAAATTATGCAGGATGG No data
946882058_946882066 28 Left 946882058 2:224186184-224186206 CCTGGGGTTCTATCCGAAAGGGC No data
Right 946882066 2:224186235-224186257 TATGCAGGATGGTGAGAGGAAGG No data
946882058_946882065 24 Left 946882058 2:224186184-224186206 CCTGGGGTTCTATCCGAAAGGGC No data
Right 946882065 2:224186231-224186253 AAATTATGCAGGATGGTGAGAGG No data
946882058_946882062 -3 Left 946882058 2:224186184-224186206 CCTGGGGTTCTATCCGAAAGGGC No data
Right 946882062 2:224186204-224186226 GGCAGAGGGTTATATTAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946882058 Original CRISPR GCCCTTTCGGATAGAACCCC AGG (reversed) Intergenic
No off target data available for this crispr