ID: 946882061

View in Genome Browser
Species Human (GRCh38)
Location 2:224186197-224186219
Sequence AATATAACCCTCTGCCCTTT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946882061_946882063 0 Left 946882061 2:224186197-224186219 CCGAAAGGGCAGAGGGTTATATT No data
Right 946882063 2:224186220-224186242 AGAGAGGAAAGAAATTATGCAGG No data
946882061_946882065 11 Left 946882061 2:224186197-224186219 CCGAAAGGGCAGAGGGTTATATT No data
Right 946882065 2:224186231-224186253 AAATTATGCAGGATGGTGAGAGG No data
946882061_946882068 17 Left 946882061 2:224186197-224186219 CCGAAAGGGCAGAGGGTTATATT No data
Right 946882068 2:224186237-224186259 TGCAGGATGGTGAGAGGAAGGGG No data
946882061_946882067 16 Left 946882061 2:224186197-224186219 CCGAAAGGGCAGAGGGTTATATT No data
Right 946882067 2:224186236-224186258 ATGCAGGATGGTGAGAGGAAGGG No data
946882061_946882064 4 Left 946882061 2:224186197-224186219 CCGAAAGGGCAGAGGGTTATATT No data
Right 946882064 2:224186224-224186246 AGGAAAGAAATTATGCAGGATGG No data
946882061_946882066 15 Left 946882061 2:224186197-224186219 CCGAAAGGGCAGAGGGTTATATT No data
Right 946882066 2:224186235-224186257 TATGCAGGATGGTGAGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946882061 Original CRISPR AATATAACCCTCTGCCCTTT CGG (reversed) Intergenic
No off target data available for this crispr