ID: 946882068

View in Genome Browser
Species Human (GRCh38)
Location 2:224186237-224186259
Sequence TGCAGGATGGTGAGAGGAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946882058_946882068 30 Left 946882058 2:224186184-224186206 CCTGGGGTTCTATCCGAAAGGGC No data
Right 946882068 2:224186237-224186259 TGCAGGATGGTGAGAGGAAGGGG No data
946882061_946882068 17 Left 946882061 2:224186197-224186219 CCGAAAGGGCAGAGGGTTATATT No data
Right 946882068 2:224186237-224186259 TGCAGGATGGTGAGAGGAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946882068 Original CRISPR TGCAGGATGGTGAGAGGAAG GGG Intergenic
No off target data available for this crispr